Supercharge Your Innovation With Domain-Expert AI Agents!

Method for screening wheat with different zinc contents and iron contents and special kit thereof

A kit and wheat technology, applied in the direction of biochemical equipment and methods, microbial measurement/testing, etc., can solve the problems of poor flexibility and low throughput

Active Publication Date: 2019-02-01
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Molecular markers commonly used for genotype identification include STS, SSR, SNP, etc., which have low throughput and poor flexibility, and are limited to a certain extent in breeding applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for screening wheat with different zinc contents and iron contents and special kit thereof
  • Method for screening wheat with different zinc contents and iron contents and special kit thereof
  • Method for screening wheat with different zinc contents and iron contents and special kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0089] Example 1, Discovery of AX-89703298 SNP site

[0090] 1. Crossing Jingdong 8 (as the female parent) and Aikang 58 (as the male parent) to obtain the hybrid F1 generation of Jingdong 8 and Aikang 58 (referred to as the hybrid F1 generation). The hybrid F1 generation was selfed to obtain the F2 population; the single-seed method was adopted until the self-crossing to obtain the RILs population. The RILs population consisted of 254 families.

[0091] 2. Under the condition of sufficient amount of soil zinc application (zinc application: 25Kg / Ha), the RILs population constructed in step 1 was planted in Shijiazhuang, Hebei and Gaoyi, Hebei respectively in 2017, and the corresponding wheat grains were harvested and threshed manually.

[0092] 3. Get the wheat grains to be measured (Jingdong No. 8 grains, Aikang 58 grains or the wheat grains obtained in step 2), and adopt an inductively coupled plasma emission spectrometer (ICP- OES) to measure zinc content and iron content...

Embodiment 2

[0108] Example 2, using the K-AX-89703298 primer set to detect the genotype of wheat based on the AX-89703298 SNP site

[0109] 1. Preparation of K-AX-89703298 primer set

[0110] According to the position of AX-89703298 SNP on the wheat chromosome 4D, the K-AX-89703298 primer set was designed and prepared. K-AX-89703298 primer set consists of primer KASP-897A: 5′- GAAGGTGACCAAGTTCATGCT CTAACCATTGGATAGGGCGAC-3' (single underline is FAM fluorescent tag sequence) (sequence 2 in the sequence listing), primer KASP-897B: (The double underline is the HEX fluorescent tag sequence) (sequence 3 in the sequence listing) and primer KASP-897C: 5'-CCCAGCTTCAGCCCATGA-3' (sequence 4 in the sequence listing).

[0111] 2. Using the K-AX-89703298 primer set to detect the genotype of wheat based on the AX-89703298 SNP site

[0112] The samples to be tested are the leaves of each family in the RILs population constructed in step 1, the leaves of Jingdong 8, the leaves of Aikang 58 or the l...

Embodiment 3

[0121] Example 3, K-AX-89703298 primer set detects genotypes based on AX-89703298 SNP loci in 50 domestic main cultivars

[0122] The wheat to be tested is 50 main varieties of wheat. See column 1 in Table 3 for the names of the 50 main varieties of wheat.

[0123] 1. Detect the genotype of the wheat to be tested based on the AX-89703298 SNP locus

[0124] (1) Extract the genomic DNA of the wheat leaves to be tested.

[0125] (2) Using the genomic DNA of the wheat to be tested as a template and using the K-AX-89703298 primer set to carry out PCR amplification to obtain PCR amplification products.

[0126] The reaction system was 10 μL, consisting of 1 μL 10×KASP Master Mix, primer KASP-897A aqueous solution, primer KASP-897B aqueous solution, primer KASP-897C aqueous solution and genomic DNA of the wheat to be tested. The reaction system is medium, the concentration of primer KASP-897A and primer KASP-897B is 0.13 μM, the concentration of primer KASP-897C is 0.34 μM, and th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for screening wheat with different zinc contents and iron contents and a special kit thereof. The method comprises the following steps: whether the genotype based on the AX-89703298 SNP site in the wheat genome to be tested is GG homozygous or TT homozygous is detected, and the GG homozygous wheat has higher trace element content than the TT homozygous wheat; the ''AX-89703298 SNP site'' is the 33rd nucleotide from the 5' end of the sequence 1 in the sequence table of the wheat genome; and the trace elements are zinc and / or iron. The invention has important application value.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for screening wheat with different zinc and iron contents and a special kit thereof. Background technique [0002] Wheat is one of the world's main food crops. In the past 50 years of breeding work, the improvement of yield, crop nutrition and health quality has become an important research direction. Like other grains, wheat grains contain low trace elements such as zinc and iron, and increasing the content of trace elements such as zinc and iron in grains of staple crops such as wheat has become a current hot research topic. The contents of zinc and iron in wheat grain were significantly affected by genotype, environment and their interaction, among which the effect of environment was the largest, followed by the effect of genotype, and the interaction effect of genotype and environment was the smallest. Therefore, it is feasible to increase the iron and zinc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6858
CPCC12Q1/6858C12Q2531/113C12Q2563/107
Inventor 张勇王悦徐小婷郝元峰何中虎
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More