Method for screening wheat with different zinc contents and iron contents and special kit thereof
A kit and wheat technology, applied in the direction of biochemical equipment and methods, microbial measurement/testing, etc., can solve the problems of poor flexibility and low throughput
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0089] Example 1, Discovery of AX-89703298 SNP site
[0090] 1. Crossing Jingdong 8 (as the female parent) and Aikang 58 (as the male parent) to obtain the hybrid F1 generation of Jingdong 8 and Aikang 58 (referred to as the hybrid F1 generation). The hybrid F1 generation was selfed to obtain the F2 population; the single-seed method was adopted until the self-crossing to obtain the RILs population. The RILs population consisted of 254 families.
[0091] 2. Under the condition of sufficient amount of soil zinc application (zinc application: 25Kg / Ha), the RILs population constructed in step 1 was planted in Shijiazhuang, Hebei and Gaoyi, Hebei respectively in 2017, and the corresponding wheat grains were harvested and threshed manually.
[0092] 3. Get the wheat grains to be measured (Jingdong No. 8 grains, Aikang 58 grains or the wheat grains obtained in step 2), and adopt an inductively coupled plasma emission spectrometer (ICP- OES) to measure zinc content and iron content...
Embodiment 2
[0108] Example 2, using the K-AX-89703298 primer set to detect the genotype of wheat based on the AX-89703298 SNP site
[0109] 1. Preparation of K-AX-89703298 primer set
[0110] According to the position of AX-89703298 SNP on the wheat chromosome 4D, the K-AX-89703298 primer set was designed and prepared. K-AX-89703298 primer set consists of primer KASP-897A: 5′- GAAGGTGACCAAGTTCATGCT CTAACCATTGGATAGGGCGAC-3' (single underline is FAM fluorescent tag sequence) (sequence 2 in the sequence listing), primer KASP-897B: (The double underline is the HEX fluorescent tag sequence) (sequence 3 in the sequence listing) and primer KASP-897C: 5'-CCCAGCTTCAGCCCATGA-3' (sequence 4 in the sequence listing).
[0111] 2. Using the K-AX-89703298 primer set to detect the genotype of wheat based on the AX-89703298 SNP site
[0112] The samples to be tested are the leaves of each family in the RILs population constructed in step 1, the leaves of Jingdong 8, the leaves of Aikang 58 or the l...
Embodiment 3
[0121] Example 3, K-AX-89703298 primer set detects genotypes based on AX-89703298 SNP loci in 50 domestic main cultivars
[0122] The wheat to be tested is 50 main varieties of wheat. See column 1 in Table 3 for the names of the 50 main varieties of wheat.
[0123] 1. Detect the genotype of the wheat to be tested based on the AX-89703298 SNP locus
[0124] (1) Extract the genomic DNA of the wheat leaves to be tested.
[0125] (2) Using the genomic DNA of the wheat to be tested as a template and using the K-AX-89703298 primer set to carry out PCR amplification to obtain PCR amplification products.
[0126] The reaction system was 10 μL, consisting of 1 μL 10×KASP Master Mix, primer KASP-897A aqueous solution, primer KASP-897B aqueous solution, primer KASP-897C aqueous solution and genomic DNA of the wheat to be tested. The reaction system is medium, the concentration of primer KASP-897A and primer KASP-897B is 0.13 μM, the concentration of primer KASP-897C is 0.34 μM, and th...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap