Unlock instant, AI-driven research and patent intelligence for your innovation.

A lamp detection kit for poplar bacterial canker

A canker fungus and bacterial technology, applied in the biological field, can solve the problems of destroying the utilization value of wood, death of the whole plant, detection of undisclosed pathogenic bacteria, etc., and achieves remarkable specificity and detection sensitivity, good specificity and sensitivity, and remarkable technical effect. Effect

Active Publication Date: 2020-06-09
SHANDONG AGRICULTURAL UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2009, the disease only occurred in the Heze area of ​​Shandong Province with an area of ​​about 40,000 mu. In some plots, the diseased plant rate was as high as 90%, and the disease index was as high as 60 or more, resulting in weak growth of poplar trees, deformed trunks, discoloration of wood, and serious damage to wood. When the festering is serious, the trunk can be broken by wind, and even the whole plant will die, which seriously affects the growth and success of poplar high-yield forests, causing major economic losses.
The method for detecting the pathogen by the LAMP method has not been disclosed in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A lamp detection kit for poplar bacterial canker
  • A lamp detection kit for poplar bacterial canker
  • A lamp detection kit for poplar bacterial canker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1: Establishment of a ring-mediated isothermal amplification detection method for poplar bacterial canker

[0060] The sample infected with poplar bacterial canker was used as the detection object, and the nucleic acid-free ddH 2 O is a negative control.

[0061] 1. Primer design:

[0062] According to the deoxyribonucleic acid sequence of poplar bacterial canker bacterium reported on NCBI, 5 sets of specific primers were designed using the LAMP primer design software Primer Explorer V5 and 3 pairs were selected from them. The primer sequences are as follows (5'-3'):

[0063] First set of primers:

[0064] F3: CGTCATCCCCACCTTCCT

[0065] B3: CAACGCGAAGAACCTTACCT

[0066] FIP: AACGAGCGCAACCCTTATCCTTCGGTTTTATCACCGGCAGTC

[0067] BIP: TCACAACACGAGCTGACGACAGCTTGGCAGAGATGCCTTGG

[0068] Second set of primers:

[0069] F3: ACTTCATGGAGTCGAGTTGC

[0070] B3: GGAACTCAAAGGAGACTGCC

[0071] FIP: TGGCGCATACAAAGAGAAGCGAAGACTCCAATCCGGACTACG

[0072] BIP: GTAGCCCTACT...

Embodiment 2

[0100] Embodiment 2: Optimization of LAMP detection system

[0101] The optimal primers that can be screened through Example 1 are the first group of primers, and the optimal detection system can be determined by screening the amplification temperature and the amplification temperature, two factors that mainly affect the construction system. Reaction system (25μL):

[0102] A: 10μL 2×U-LAMP Mix; 2μl Tempalte DNA; 1μL Bst DNA polymerase; 8μL ddH 2 O, 1.0 μL of primers (F3 and B3) among primers, 1.0 μL of primers (FIP and BIP) among primers, reaction conditions: 60°C for 30 minutes; 80°C for 10 minutes.

[0103] B: 10μL 2×U-LAMP Mix; 2μl Tempalte DNA; 1μL Bst DNA polymerase; 8μL ddH 2 O, 1.0 μL of primers (F3 and B3) among primers, 1.0 μL of primers (FIP and BIP) among primers, reaction conditions: 65°C for 30 minutes; 80°C for 10 minutes.

[0104] C: 10 μL 2×U-LAMP Mix; 2 μl Tempalte DNA; 1 μL Bst DNA polymerase; 8 μL ddH 2 O, 1.0 μL of primers (F3 and B3) among primers, 1....

Embodiment 3

[0112] Embodiment 3: Specificity and stability of LAMP detection method in the present invention

[0113] According to the reaction E system and reaction conditions of the above-mentioned Example 2, the susceptible samples of Xanthomonas oryzaepv. oryzae (Ishiyama), Bacillus sonorensis, Bacillus subtilis, and Pantoea ananatis were tested at the same time to test the specificity and stability of the LAMP method. Use the extracted DNA from Xanthomonas oryzaepv.oryzae (Ishiyama), Bacillus sonorensis, Bacillus subtilis, and Pantoea ananatis susceptible samples as detection templates for LAMP amplification reaction, and use 1.0% agarose gel electrophoresis for LAMP results and add calcein The solution was analyzed by visual inspection in two ways. pass Figure 5 , 6 It can be seen that only in the Lonsdaleaquercina subsp.populi reaction tube, there was a positive reaction and specific emerald green fluorescence, and the other reaction tubes were all negative. The results show th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology and particularly relates to a Loop-mediated isothermal amplification (LAMP) detection kit for Lonsdalea quercina subsp.populi. Through research,it is shown that aplanobacterium populi ride pathogenic bacteria is caused by the Lonsdalea quercina subsp.populi, and LAMP serving as a constant-temperature nucleic acid amplification technology hasthe advantages that reaction can be conducted at the constant temperature, specificity is high, sensitivity is high, and the reaction speed is high. The Lonsdalea quercina subsp.populi is detected onthe basis of LAMP, a primer combination with the good specificity and sensitivity is obtained through screening, the detection sensitivity can reach 10-12, and the LAMP detection kit has important significance of application to prevention and control over aplanobacterium populi ride diseases and agent screening.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a LAMP detection kit for Lonsdaleaquercina subsp.populi and a method for using it. Background technique [0002] The new bacterial canker of poplar caused by Lonsdalea quercina subsp. populi is a devastating disease that harms the branches of poplar plantation newly discovered in northern my country in 2005. According to investigations, the disease has seriously occurred in Shandong, Henan and other places in my country. In 2009, the disease only occurred in the Heze area of ​​Shandong Province with an area of ​​about 40,000 mu, and the diseased plant rate in some plots was as high as 90%, and the disease index was as high as 60 or more, resulting in weak growth of poplar trees, deformed trunks, discoloration of wood, and serious damage to wood When the festering is serious, the trunk can be broken by wind, and even the whole plant dies, which seriously affects the growt...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6844C12Q1/04C12N15/11C12R1/01
CPCC12Q1/6844C12Q2531/119C12Q2563/107
Inventor 刘会香于成明陆红艳何邦令王海明
Owner SHANDONG AGRICULTURAL UNIVERSITY