A lamp detection kit for poplar bacterial canker
A canker fungus and bacterial technology, applied in the biological field, can solve the problems of destroying the utilization value of wood, death of the whole plant, detection of undisclosed pathogenic bacteria, etc., and achieves remarkable specificity and detection sensitivity, good specificity and sensitivity, and remarkable technical effect. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Example 1: Establishment of a ring-mediated isothermal amplification detection method for poplar bacterial canker
[0060] The sample infected with poplar bacterial canker was used as the detection object, and the nucleic acid-free ddH 2 O is a negative control.
[0061] 1. Primer design:
[0062] According to the deoxyribonucleic acid sequence of poplar bacterial canker bacterium reported on NCBI, 5 sets of specific primers were designed using the LAMP primer design software Primer Explorer V5 and 3 pairs were selected from them. The primer sequences are as follows (5'-3'):
[0063] First set of primers:
[0064] F3: CGTCATCCCCACCTTCCT
[0065] B3: CAACGCGAAGAACCTTACCT
[0066] FIP: AACGAGCGCAACCCTTATCCTTCGGTTTTATCACCGGCAGTC
[0067] BIP: TCACAACACGAGCTGACGACAGCTTGGCAGAGATGCCTTGG
[0068] Second set of primers:
[0069] F3: ACTTCATGGAGTCGAGTTGC
[0070] B3: GGAACTCAAAGGAGACTGCC
[0071] FIP: TGGCGCATACAAAGAGAAGCGAAGACTCCAATCCGGACTACG
[0072] BIP: GTAGCCCTACT...
Embodiment 2
[0100] Embodiment 2: Optimization of LAMP detection system
[0101] The optimal primers that can be screened through Example 1 are the first group of primers, and the optimal detection system can be determined by screening the amplification temperature and the amplification temperature, two factors that mainly affect the construction system. Reaction system (25μL):
[0102] A: 10μL 2×U-LAMP Mix; 2μl Tempalte DNA; 1μL Bst DNA polymerase; 8μL ddH 2 O, 1.0 μL of primers (F3 and B3) among primers, 1.0 μL of primers (FIP and BIP) among primers, reaction conditions: 60°C for 30 minutes; 80°C for 10 minutes.
[0103] B: 10μL 2×U-LAMP Mix; 2μl Tempalte DNA; 1μL Bst DNA polymerase; 8μL ddH 2 O, 1.0 μL of primers (F3 and B3) among primers, 1.0 μL of primers (FIP and BIP) among primers, reaction conditions: 65°C for 30 minutes; 80°C for 10 minutes.
[0104] C: 10 μL 2×U-LAMP Mix; 2 μl Tempalte DNA; 1 μL Bst DNA polymerase; 8 μL ddH 2 O, 1.0 μL of primers (F3 and B3) among primers, 1....
Embodiment 3
[0112] Embodiment 3: Specificity and stability of LAMP detection method in the present invention
[0113] According to the reaction E system and reaction conditions of the above-mentioned Example 2, the susceptible samples of Xanthomonas oryzaepv. oryzae (Ishiyama), Bacillus sonorensis, Bacillus subtilis, and Pantoea ananatis were tested at the same time to test the specificity and stability of the LAMP method. Use the extracted DNA from Xanthomonas oryzaepv.oryzae (Ishiyama), Bacillus sonorensis, Bacillus subtilis, and Pantoea ananatis susceptible samples as detection templates for LAMP amplification reaction, and use 1.0% agarose gel electrophoresis for LAMP results and add calcein The solution was analyzed by visual inspection in two ways. pass Figure 5 , 6 It can be seen that only in the Lonsdaleaquercina subsp.populi reaction tube, there was a positive reaction and specific emerald green fluorescence, and the other reaction tubes were all negative. The results show th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


