Method for establishing NOD-Rag2nullIL-2Rgamma null immune deficiency mouse by using gene edition technique

A technology of gene editing and defective mice, applied in other methods of inserting foreign genetic materials, genetic engineering, using microinjection, etc., to meet the research needs

Inactive Publication Date: 2019-03-15
GUANGZHOU JENNIO BIOLOGICAL TECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the existing immunodeficiency animal models can not well meet the needs of drug testing and heterog

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0023] Example: The present invention uses gene editing technology to construct a method for NOD-Rag2null IL-2Rγnull immunodeficiency mice, which includes the following steps:

[0024] (1) Use CAS9 technology to knock out the Rag2 and IL-2Rγ genes in the mouse embryo genome, thereby making the mouse immune system defective, and constructing DNA that causes the immune-related genes in the mouse embryo to lose function. The sequence is as follows:

[0025] Rag2 boot sequence: GAGCGTGAGGTTGGTTGCCTG; Rag2 Donor sequences: GTCTTATAATTCTAAGACAAGCATGTAAAATGACTTTTCTTTTAAACAAGCCTTTTGTATGAGGAAGAATCTAAGCATAATTACCAATATGAAAAGATATTCTAAGTTATTGCGTTTTTTTAATCCTTTCAGATAAAAGACCTATTCACAATCAAAAATGTCCCTGCAGATGGTAACAGTGGGTCATAACATAGCCTTAATTCAACCAGGCTTCTCACTTATGAATTTTGATGGCCAAGTTTTCTTCTTTGGCCAGAAAGGCTGGCCTAAGAGATCCTGTCCTACTGGAGTCTTTCATTTTGATATAAAACAAAATCATCTCAAACTGAAGCCTGCAATCTTCTCTAAAGATTCCTGCTACCTCCCACCTCACCGTTATCCAGCTACTTGCTCATAAAAAGGCAGCATAGACTCTGACAAGCATCAATATATCATTCACGGAGGGAAAACACCAAACAATGAGCTTTCCGATAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of biologics and discloses a method for establishing NOD-Rag2nullIL-2Rgamma null immune deficiency mice by using a gene edition technique. The method comprises the following steps: (1) knocking off genes Rag2 and IL-2Rgamma in a mouse embryo genome by using a CAS9 technique so as to delete immune systems of mice, and establishing DNA (Deoxyribonucleic Acid) without immune related gene functions of mouse embryos; (2) purifying the DNA established in the step (1), and carrying out in vitro transcription with SP6 reverse transcriptase so as to obtain mRNA; (3) purifying the mRNA obtained in the step (2), and cryopreserving in ultrapure water without an RNA enzyme for later micro-injection; and (4) under an SPF grade breeding condition, breeding fertilized female mice and pseudopregnancy female mice. By using the latest CAS9 gene edition technique, specific knockoff of the genes Rag2 and IL-2Rgamma is carried out, immune deficiency of T, B and NK is achieved, blanks of strains of different gene edition types are made up, and requirements of animal testing and disease model research can be met.

Description

Technical field [0001] The invention specifically relates to a method for constructing NOD-Rag2null IL-2Rγnull immunodeficiency mice by using gene editing technology, and belongs to the field of biotechnology. Background technique [0002] Animal models are mainly used for experimental physiology, experimental pathology and experimental therapeutics (including new drug screening) research. The development of human diseases is very complicated. People themselves are used as experimental subjects to explore the mechanism of disease in depth, and the development of medicine has been slow. The accumulated clinical experience not only has limitations in time and space, but many experiments are morally based. And methods are also restricted. With the help of indirect research on animal models, it is possible to consciously change those factors that are impossible or difficult to exclude under natural conditions, so as to more accurately observe the experimental results of the model an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/90C12N15/89C12N9/22A01K67/027
CPCA01K67/0275A01K2217/075A01K2227/105A01K2267/0387C12N9/22C12N15/89C12N15/907
Inventor 胡策
Owner GUANGZHOU JENNIO BIOLOGICAL TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap