HRM (high resolution melt)-based multiplex LAMP (loop mediated isothermal amplification) detection method and kit
A high-resolution melting, ring-mediated isothermal technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc. The effect of LAMP detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0028] The present invention will be described in further detail below in conjunction with the accompanying drawings and embodiments. The examples are only used to explain the present invention, not to limit the protection scope of the present invention.
[0029] Based on the differences in Tm values of three amplified target fragments (ie target sequences), the present invention establishes a multiple LAMP detection technology based on high-resolution melting curve analysis (HRM) identification.
[0030] (1) Feasibility of multiple loop-mediated isothermal nucleic acid amplification and high-resolution melting detection
[0031] 1. Design LAMP primers
[0032] 1.1 Use the conserved sequence of the fem gene of Staphylococcus aureus as the target sequence S1, and the specific primers for amplifying S1 are:
[0033] S. aur-F 3 (5'-3'): TTTAACAGCTAAAGAGTTTGGT
[0034] S. aur-B 3 (5'-3'): TTTCATAATCGATCACTGGAC
[0035] S. aur-FIP (5'-3'): CCTTCAGCAAAGCTTTAACTCATAGTTTTTCAGATA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


