Genetic markers related to plateau hypoxia adaptation of Tibetan sheep and their application
A plateau hypoxia and genetic marker technology, applied in the field of genetic markers, can solve problems such as lack of systematic research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] 1 Materials and methods
[0046] 1.1 Experimental animals and sample collection
[0047] Selected 280 adult Tibetan sheep aged 1.5 to 3 years old (collected in Maqu County, Gansu Province, about 4000m above sea level) and 204 lake sheep (collected in Lin'an District, Zhejiang Province, about 100m above sea level), jugular vein blood samples were collected 5ml in vacuum collection vessels containing anticoagulants for the extraction of genomic DNA and the determination of blood indicators. Slaughter 3 Tibetan sheep and 3 lake sheep ewes aged 3 years old, immediately collect the heart, liver, spleen, lungs, kidneys, dorsal longest muscle and fat tissue, and quickly transfer them to liquid nitrogen for preservation, and bring them back to the laboratory and store them in the -80 °C refrigerator for storage.
[0048] 1.2 Determination of blood indicators
[0049] Determination of partial pressure (PCO) of carbon dioxide in blood using the American DL-1600 Blood Gas Analyzer 2 )...
Embodiment 2
[0103] Kits to detect low-oxygen fitness on the Tibetan sheep plateau, including:
[0104] 1. Primer pairs
[0105] Upstream primers: GATAGAACGCAACAAGGAGAA
[0106] Downstream primers: CCTGGAGTCCTGAACATAG.
[0107] 2. PCR detection reagent
[0108] The PCR reaction system is 20.0 μL, Mix reagent (Tiangen Biochemical Technology, Beijing) 10 μL, dd H 2 O8.4 μL, upstream and downstream primers (5 μmol / L) 0.4 μL each, genomic DNA (100 ng / μL) 0.8 μL.
[0109] PCR reaction conditions are: 95 °C prenaturation for 5 min; 94 °C denaturation 30s, 62 °C annealing 30s, 72 °C extension 30s, 35 cycles; Extend at 72 °C for 10 min, store at 4 °C.
[0110] 3. SSCP loading denaturation buffer
[0111] 98% deionized formamide, 0.025% xylene cyanide, 0.025% bromophenol blue, 10 mmol / L EDTA.
[0112] 4. Standard sample
[0113] Standard sample A: its nucleotide sequence is seq ID No.1;
[0114] Standard sample B: its nucleotide sequence is seq ID No.2;
[0115] Standard Sample C: Its nucleotide sequenc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


