Unlock instant, AI-driven research and patent intelligence for your innovation.

Genetic markers related to plateau hypoxia adaptation of Tibetan sheep and their application

A plateau hypoxia and genetic marker technology, applied in the field of genetic markers, can solve problems such as lack of systematic research

Active Publication Date: 2022-06-07
GANSU AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, research on hypoxic adaptation at home and abroad is mainly focused on the physiological and biochemical, molecular regulation mechanism and epigenetic mechanism of human hypoxic adaptation. There is still a lack of systematic research on the physiological, biochemical and molecular genetic mechanism of hypoxic adaptation in plateau animals.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic markers related to plateau hypoxia adaptation of Tibetan sheep and their application
  • Genetic markers related to plateau hypoxia adaptation of Tibetan sheep and their application
  • Genetic markers related to plateau hypoxia adaptation of Tibetan sheep and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] 1 Materials and methods

[0046] 1.1 Experimental animals and sample collection

[0047] Selected 280 adult Tibetan sheep aged 1.5 to 3 years old (collected in Maqu County, Gansu Province, about 4000m above sea level) and 204 lake sheep (collected in Lin'an District, Zhejiang Province, about 100m above sea level), jugular vein blood samples were collected 5ml in vacuum collection vessels containing anticoagulants for the extraction of genomic DNA and the determination of blood indicators. Slaughter 3 Tibetan sheep and 3 lake sheep ewes aged 3 years old, immediately collect the heart, liver, spleen, lungs, kidneys, dorsal longest muscle and fat tissue, and quickly transfer them to liquid nitrogen for preservation, and bring them back to the laboratory and store them in the -80 °C refrigerator for storage.

[0048] 1.2 Determination of blood indicators

[0049] Determination of partial pressure (PCO) of carbon dioxide in blood using the American DL-1600 Blood Gas Analyzer 2 )...

Embodiment 2

[0103] Kits to detect low-oxygen fitness on the Tibetan sheep plateau, including:

[0104] 1. Primer pairs

[0105] Upstream primers: GATAGAACGCAACAAGGAGAA

[0106] Downstream primers: CCTGGAGTCCTGAACATAG.

[0107] 2. PCR detection reagent

[0108] The PCR reaction system is 20.0 μL, Mix reagent (Tiangen Biochemical Technology, Beijing) 10 μL, dd H 2 O8.4 μL, upstream and downstream primers (5 μmol / L) 0.4 μL each, genomic DNA (100 ng / μL) 0.8 μL.

[0109] PCR reaction conditions are: 95 °C prenaturation for 5 min; 94 °C denaturation 30s, 62 °C annealing 30s, 72 °C extension 30s, 35 cycles; Extend at 72 °C for 10 min, store at 4 °C.

[0110] 3. SSCP loading denaturation buffer

[0111] 98% deionized formamide, 0.025% xylene cyanide, 0.025% bromophenol blue, 10 mmol / L EDTA.

[0112] 4. Standard sample

[0113] Standard sample A: its nucleotide sequence is seq ID No.1;

[0114] Standard sample B: its nucleotide sequence is seq ID No.2;

[0115] Standard Sample C: Its nucleotide sequenc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetic marker related to plateau hypoxia adaptability of Tibetan sheep, which is characterized in that: it is located on the HMOX1 gene, and there are four dominant genotypes AA, BB, AB and AC; the genotypes of Tibetan sheep are AA and BB When the genotype of Tibetan sheep is AB, Tibetan sheep have poor adaptability to plateau hypoxia. The invention also provides its application in breeding Tibetan sheep with good adaptability to plateau hypoxia. The genetic marker disclosed by the invention can be used to identify the adaptability of Tibetan sheep to plateau hypoxia, and can also be used to breed Tibetan sheep with good adaptability to plateau hypoxia.

Description

Technical field [0001] The present invention belongs to the field of molecular biology techniques, specifically relates to genetic markers associated with low-oxygen adaptation to the Tibetan sheep plateau and their applications. Background [0002] Hem oxygenase (HMOX) is a key rate-limiting enzyme in heme metabolism, which produces bilirubin by oxidizing heme, which is then converted into bilirubin by bilirubin reductase to metabolize excess heme in the body. Metabolites produced by catalyzing heme degradation play an important role in antioxidant, anti-inflammatory, defense against apoptosis, transmission of neuronal information, and regulation of vascular tone (Shibahara et al., 1999; McCoubreyet al., 1997; Sun et al., 2003; Li Yanli et al., 2017). There are three forms of isomerase in heme oxygenase: stress-induced HMOX1, constitutive HMOX2, and function-unknown HMOX3 (Sun et al., 2003). When cells and tissues are in a stressed state, HMOX1 can be induced as a protective pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/156C12Q2600/124Y02P60/87
Inventor 刘秀贺延玉何建文张伟李少斌胡江王继卿罗玉柱
Owner GANSU AGRI UNIV