Unlock instant, AI-driven research and patent intelligence for your innovation.

Genetic marker related to high-altitude hypoxia adaptability of Tibet sheep

A high-altitude hypoxia, genetic marker technology, applied in the field of genetic markers, can solve problems such as lack of systematic research

Active Publication Date: 2019-04-05
GANSU AGRI UNIV
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, research on hypoxic adaptation at home and abroad is mainly focused on the physiological and biochemical, molecular regulation mechanism and epigenetic mechanism of human hypoxic adaptation. There is still a lack of systematic research on the physiological, biochemical and molecular genetic mechanism of hypoxic adaptation in plateau animals.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic marker related to high-altitude hypoxia adaptability of Tibet sheep
  • Genetic marker related to high-altitude hypoxia adaptability of Tibet sheep
  • Genetic marker related to high-altitude hypoxia adaptability of Tibet sheep

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] 1Materials and methods

[0046] 1.1 Laboratory animals and sample collection

[0047] Choose 280 adult Tibetan sheep (collected in Maqu County, Gansu Province, with an altitude of about 4000m) and 204 Hu sheep (collected in Lin'an District, Zhejiang Province, with an altitude of about 100m) aged 1.5 to 3 years old. Collect 5ml blood sample from the jugular vein in a vacuum blood collection tube containing anticoagulant for extracting genomic DNA and measuring blood indicators. Slaughter 3 year old Tibetan sheep and 3 Hu sheep ewes each, immediately collect heart, liver, spleen, lung, kidney, longissimus dorsi muscle and adipose tissue, and quickly transfer them to liquid nitrogen for storage, and bring them back to the laboratory for storage Store in the refrigerator at -80℃ for later use.

[0048] 1.2 Determination of blood indicators

[0049] The American DL-1600 blood gas analyzer was used to measure the partial pressure of carbon dioxide (PCO) in the blood. 2 ), oxygen pa...

Embodiment 2

[0103] The kit for testing the adaptability of Tibetan sheep to hypoxia in plateau includes:

[0104] 1. Primer pair

[0105] Upstream primer: GATAGAACGCAACAAGGAGAA

[0106] Downstream primer: CCTGGAGTCGCTGAACATAG.

[0107] 2. PCR detection reagents

[0108] PCR reaction system is 20.0μL, Mix reagent (Tiangen Biochemical Technology, Beijing) 10μL, dd H 2 O8.4μL, 0.4μL of upstream and downstream primers (5μmol / L), 0.8μL of genomic DNA (100ng / μL).

[0109] The PCR reaction conditions were: pre-denaturation at 95°C for 5 minutes; denaturation at 94°C for 30s, annealing at 62°C for 30s, extension at 72°C for 30s, 35 cycles; extension at 72°C for 10 minutes, and storage at 4°C.

[0110] 3. SSCP loading and denaturing buffer

[0111] 98% deionized formamide, 0.025% xylene cyanide, 0.025% bromophenol blue, 10mmol / L EDTA.

[0112] 4. Standard sample

[0113] Standard sample A: Its nucleotide sequence is SEQ ID No. 1 in the sequence listing;

[0114] Standard B: Its nucleotide sequence is SEQ ID No. 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetic marker related to high-altitude hypoxia adaptability of Tibet sheep. The genetic marker is characterized in that the genetic marker is located on an HMOX1 (Hem Oxygenase 1) gene and has four dominant genotypes of AA, BB, AB and AC; when the genotypes of the Tibet sheet are AA, BB and AC, the high-altitude hypoxia adaptability of the Tibet sheep is good; when the genotype of the Tibet sheep is AB, the high-altitude hypoxia adaptability of the Tibet sheep is poor. The invention also provides application of the genetic marker in breeding the Tibet sheep with goodhigh-altitude hypoxia adaptability. The genetic marker disclosed by the invention can be used for identifying the degree of the high-altitude hypoxia adaptability of the Tibet sheep and can also be used for breeding the Tibet sheep with good high-altitude hypoxia adaptability.

Description

Technical field [0001] The invention belongs to the technical field of molecular biology, and specifically relates to genetic markers related to Tibetan sheep plateau hypoxia adaptability and applications thereof. Background technique [0002] Heme oxygenase (HMOX) is a key rate-limiting enzyme in heme metabolism. It oxidizes heme to produce biliverdin, which is then converted into bilirubin by biliverdin reductase. Metabolize excess heme in the body. The metabolites produced by catalyzing the degradation of heme play an important role in anti-oxidation, anti-inflammatory, defense against cell apoptosis, transmitting neuronal information and regulating vascular tone (Shibahara et al., 1999; McCubrey et al., 1997; Sun et al., 2003; Li Yanli et al., 2017). There are three isomerase forms of heme oxygenase: stress-induced HMOX1, constitutive HMOX2 and HMOX3 whose function is not yet clear (Sun et al., 2003). When cells and tissues are under stress, HMOX1 can be induced as a prote...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/156C12Q2600/124Y02P60/87
Inventor 贺延玉刘秀何建文张伟李少斌胡江王继卿罗玉柱
Owner GANSU AGRI UNIV