Genetic marker related to high-altitude hypoxia adaptability of Tibet sheep
A high-altitude hypoxia, genetic marker technology, applied in the field of genetic markers, can solve problems such as lack of systematic research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] 1Materials and methods
[0046] 1.1 Laboratory animals and sample collection
[0047] Choose 280 adult Tibetan sheep (collected in Maqu County, Gansu Province, with an altitude of about 4000m) and 204 Hu sheep (collected in Lin'an District, Zhejiang Province, with an altitude of about 100m) aged 1.5 to 3 years old. Collect 5ml blood sample from the jugular vein in a vacuum blood collection tube containing anticoagulant for extracting genomic DNA and measuring blood indicators. Slaughter 3 year old Tibetan sheep and 3 Hu sheep ewes each, immediately collect heart, liver, spleen, lung, kidney, longissimus dorsi muscle and adipose tissue, and quickly transfer them to liquid nitrogen for storage, and bring them back to the laboratory for storage Store in the refrigerator at -80℃ for later use.
[0048] 1.2 Determination of blood indicators
[0049] The American DL-1600 blood gas analyzer was used to measure the partial pressure of carbon dioxide (PCO) in the blood. 2 ), oxygen pa...
Embodiment 2
[0103] The kit for testing the adaptability of Tibetan sheep to hypoxia in plateau includes:
[0104] 1. Primer pair
[0105] Upstream primer: GATAGAACGCAACAAGGAGAA
[0106] Downstream primer: CCTGGAGTCGCTGAACATAG.
[0107] 2. PCR detection reagents
[0108] PCR reaction system is 20.0μL, Mix reagent (Tiangen Biochemical Technology, Beijing) 10μL, dd H 2 O8.4μL, 0.4μL of upstream and downstream primers (5μmol / L), 0.8μL of genomic DNA (100ng / μL).
[0109] The PCR reaction conditions were: pre-denaturation at 95°C for 5 minutes; denaturation at 94°C for 30s, annealing at 62°C for 30s, extension at 72°C for 30s, 35 cycles; extension at 72°C for 10 minutes, and storage at 4°C.
[0110] 3. SSCP loading and denaturing buffer
[0111] 98% deionized formamide, 0.025% xylene cyanide, 0.025% bromophenol blue, 10mmol / L EDTA.
[0112] 4. Standard sample
[0113] Standard sample A: Its nucleotide sequence is SEQ ID No. 1 in the sequence listing;
[0114] Standard B: Its nucleotide sequence is SEQ ID No. 2...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


