Method for knocking out plutella xylostella APN1 gene with CRISPR/Cas9 gene editing system and application of method

A gene knockout and Plutella xylostella technology, applied in the field of genetic engineering, can solve the problems of cumbersome identification process and insufficient verification methods, and achieve the effect of simple operation and high gene editing efficiency

Inactive Publication Date: 2019-04-09
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the problems that the existing methods for verifying the molecular mechanism of Plutella xylostella Bt resistance are insufficient and the identification process is too cumbersome, the present invention provides a non-destructive detection method that uses the CRISPR / Cas9 gene editing system to knock out the APN1 gene of Plutella xylostella and uses genotype screening A homozygous mutant of the Plutella xylostella APN1 gene was produced. Through the biological assay of the Bt toxin Cry1Ac, the resistance level of the APN1 gene mutant Plutella xylostella to Bt Cry1Ac insecticidal protein was detected, and the relationship between the Plutella xylostella APN1 gene and Bt Cry1Ac insecticidal protein was described. resistance relationship between proteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for knocking out plutella xylostella APN1 gene with CRISPR/Cas9 gene editing system and application of method
  • Method for knocking out plutella xylostella APN1 gene with CRISPR/Cas9 gene editing system and application of method
  • Method for knocking out plutella xylostella APN1 gene with CRISPR/Cas9 gene editing system and application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] Design and synthesis of sgRNA target sequence of Plutella xylostella APN1 gene

[0021] 1. Use the Cas-Designer software (http: / / www.rgenome.net / cas-designer / ) to design the sgRNA target sequence (the nucleotide sequence) in the specific region (the 12th exon) of the Plutella xylostella APN1 gene Shown in SEQ ID NO. 1), such as figure 2 shown, and search the diamondback moth DBM-DB genome database (http: / / 59.79.254.1 / DBM / index.php) and CRISPR off-target effect detection Cas-OFFinder software (http: / / www.rgenome.net / cas-offinder / ), to detect potential off-target sites.

[0022] 2. Add the T7 promoter sequence before the sgRNA core site AGGCCGTGGGTGTACTGCGC, and add the sequence complementary to crRNA / tracrRNA after the sgRNA core site to form the complete 5′-end DNA fragment of the sgRNA.

[0023] 3. The 80-bp crRNA / tracrRNA sequence and the sgRNA 5' end DNA fragment in step 2 undergo PCR denaturation, annealing, and extension to synthesize a complete sgRNA deoxynu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for knocking out a non-model organism plutella xylostella APN1 gene with CRISPR / Cas9 and an application of the method in molecular research on Bt Cry1Ac insecticidal protein resistance mechanisms. According to the method, a specific sgRNA target sequence of the plutella xylostella APN1 gene is designed and synthesized, sgRNA and Cas9 protein are mixed, the mixtureis microscopically injected into the posterior pole part of early embryonic disc stage eggs of plutella xylostella, plutella xylostella APN1 gene homozygous mutant populations with stable heredity arescreened out by a CRISPR / Cas9 gene editing system and applied to toxicity bioassay of Bt Cry1Ac insecticidal protein, which proves that plutella xylostella APN1 gene mutation can cause high resistance to Bt Cry1Ac insecticidal protein. The method is simple and efficient, time and labor are saved, technical support is provided for deep research on functional genes in non-model organisms, and a foundation is laid for exploring new pest control strategies.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the knockout of the APN1 gene of the diamondback moth and its application in the study of the resistance molecular mechanism of the BtCry1Ac insecticidal protein of the diamondback moth. Background technique [0002] diamondback moth [ Plutella xylostella (L.)] is a worldwide specialized pest of cruciferous crops, and it is also one of the most serious insecticide-resistant pests. And with the extensive cultivation of cruciferous vegetables in various places, diamondback moth has caused great threat to the production of cruciferous vegetables in the world. Bacillus thuringiensis ( Bacillus thuringiensis , Bt) can produce Cry-type insecticidal crystal protein, which has specific poisonous effect on various insects. It is currently the most widely used and produced microbial insecticide in the world, accounting for more than 95% of the total microbial insecticide , has been ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/90
CPCC12N9/485C12N15/113C12N15/902C12N2310/10C12Y304/11C12N2310/20
Inventor张友军郭兆将孙丹康师郭乐周君雷龚莉君覃舰莹朱流红白杨罗亮
OwnerINST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI