Method for rapidly detecting 3'-5' exo-activity of DNA polymerase or mismatching and kit thereof

A polymerase and kit technology, applied in the field of molecular biology, can solve the problems of inapplicability of sequencing enzyme exo-cutting activity detection and screening, inapplicability of sequencing enzyme detection and screening, inability to detect DNA polymerase exo-cutting activity, etc.

Active Publication Date: 2019-04-19
MGI TECH CO LTD
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods cannot detect the exosome activity of DNA polymerase in the presence of a single dNTP that does not match the deoxynucleotide at the position to be tested.
[0005] Other 3'-5'exolytic activity detection methods are also limited to detecting the 3'-5'exolytic activity of DNA polymerase when the 3'end is mismatched, and cannot detect the activity of DNA polymerase when the 3'end is paired correctly. 3'-5' exo activity
Therefore, it cannot be applied to the detection and screening of exonuclease activity of some sequencing enzymes
The traditional detection methods of DNA polymerase mismatch rate (such as blue-white spot test, plasmid endo-cutting test) are cumbersome to operate, and cannot be applied to the detection and screening of sequencing enzymes with special needs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly detecting 3'-5' exo-activity of DNA polymerase or mismatching and kit thereof
  • Method for rapidly detecting 3'-5' exo-activity of DNA polymerase or mismatching and kit thereof
  • Method for rapidly detecting 3'-5' exo-activity of DNA polymerase or mismatching and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The DNA sequence (template) immobilized on the solid phase can be immobilized on the chip or magnetic beads, and this embodiment is carried out on the nucleic acid sequence (DNB, DNA nanoball) immobilized on the chip.

[0041] 1. Equipment:

[0042] Bgiseq1000 sequencer (BGI), sequencing chip (BGI), VWR heating plate, PCR machine, PCR eight-tube.

[0043] 2. Reagents:

[0044] The reagents used in this example are shown in Table 1 below.

[0045] Table 1 Reagents

[0046]

[0047]

[0048] The fixed sequence on the DNB used in this embodiment is:

[0049] AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTGCAT (SEQ ID NO: 1).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting 3'-5' exo-activity of DNA polymerase or mismatching and a kit thereof. The method comprises the following steps: providing a nucleic acid of a known sequence, detecting a primer which is complementary to a nucleic acid with the known sequence, wherein the last deoxynucleotide at the 3' hydroxyl end and the first two deoxynucleotides to-be-polymerizedare different from each other; hybridizing the nucleic acid with the known sequence and a detection primer, and adding the DNA polymerase to be tested and the fluorescently labeled deoxynucleotide different from the deoxynucleotide to-be-polymerized for the first signal collection; adding exo-free Taq DNA polymerase and adding the first fluorescently labeled deoxynucleotide to-be-polymerized andthe second fluorescently labeled deoxynucleotide to-be-polymerized, and performing secondary signal collection; comprehensively analyzing a first signal and a second signal to determine whether the DNA polymerase to-be-tested is circumscribed or mismatched. The method can detect DNA polymerase 3'-5' exo-activity or mismatching when four nucleotides are present alone in a reaction system.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a method and a kit for rapidly detecting DNA polymerase 3'-5' excision activity or mismatch. Background technique [0002] The use of dNTPs with free hydroxyl groups at the 3' end for sequencing can greatly increase the sequencing speed. New sequencing technologies such as single-molecule sequencing are more inclined to use this 3'-OH dNTP to achieve the goal of fast and long read length. However, when using this kind of dNTP, in many cases, four deoxynucleotides need to be added separately in a certain order, and only one kind is added at a time, which requires that the DNA polymerase used has only one kind of dNTP in the reaction system When present, it can faithfully add correctly paired dNTPs sequentially, without 3'-5' exoactivity or mismatch. In practical applications, it was found that when four dNTPs are present at the same time, there is no 3'-5' exoactivity ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6816C12Q1/34
CPCC12Q1/34C12Q1/6816G01N2333/922C12Q2563/107C12Q2521/101
Inventor王静静章文蔚陈奥徐崇钧龚梅花罗银铃罗宇芬李长英
OwnerMGI TECH CO LTD