Method and kit for rapid detection of DNA polymerase 3'-5' exo-activity or mismatch
A polymerase and kit technology, applied in the field of molecular biology, can solve the problems of inability to detect DNA polymerase exocleavage activity, cumbersome operation, inability to apply sequencing enzyme detection and screening, etc.
Active Publication Date: 2022-06-03
MGI TECH CO LTD
View PDF8 Cites 0 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
However, these methods cannot detect the exosome activity of DNA polymerase in the presence of a single dNTP that does not match the deoxynucleotide at the position to be tested.
[0005] Other 3'-5'exolytic activity detection methods are also limited to detecting the 3'-5'exolytic activity of DNA polymerase when the 3'end is mismatched, and cannot detect the activity of DNA polymerase when the 3'end is paired correctly. 3'-5' exo activity
Therefore, it cannot be applied to the detection and screening of exonuclease activity of some sequencing enzymes
The traditional detection methods of DNA polymerase mismatch rate (such as blue-white spot test, plasmid endo-cutting test) are cumbersome to operate, and cannot be applied to the detection and screening of sequencing enzymes with special needs
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
Nucleic acid sequences (DNB, DNA nanoball) immobilized on the chip are performed.
1. Equipment:
[0042] Bgiseq1000 sequencer (BGI), sequencing chip (BGI), VWR heating plate, PCR instrument, PCR eight-connected tubes.
2. Reagent:
[0044] The reagents used in this example are shown in Table 1 below.
Table 1 reagent
[0046]
[0047]
The fixed sequence on the DNB used in the present embodiment is:
[0049] AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTGCAT (SEQ ID NO: 1).
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
Methods and kits for rapid detection of DNA polymerase 3'‑5' exonuclease activity or mismatches. The method includes: providing a nucleic acid of known sequence, and detection primers, which are complementary to the nucleic acid of known sequence, and the last deoxynucleotide at the 3' hydroxyl end and the first two deoxynucleotides to be polymerized are different from each other ;Hybridize the nucleic acid of known sequence and the detection primer, add the DNA polymerase to be tested and the deoxynucleotide with fluorescent label, which is different from the deoxynucleotide to be polymerized, for the first signal collection; Taq DNA polymerase, and add the first deoxynucleotide to be polymerized with fluorescent label and the second deoxynucleotide to be polymerized with fluorescent label, and carry out the second signal collection; comprehensive analysis first The secondary signal and the second signal are used to determine whether the DNA polymerase to be tested undergoes excision or mismatch. It can detect DNA polymerase 3'‑5' exoactivity or mismatch when four nucleotides exist alone in the reaction system.
Description
Method and kit for rapid detection of DNA polymerase 3'-5' exonucleation activity or mismatch technical field The present invention relates to molecular biology technical field, be specifically related to a kind of rapid detection DNA polymerase 3 '-5 ' exo-cutting activity Methods and kits for sex or mismatch. Background technique [0002] The dNTP with a free hydroxyl group at the 3' end is used in sequencing, which can greatly improve the sequencing speed. New sequencing technologies such as single Molecular sequencing, etc. prefer to use this 3'-OH dNTP to achieve the goal of fast and long read length. But using this In the case of dNTP, in many cases, four deoxynucleotides need to be added separately in a certain order, and only one is added at a time. This requires that the DNA polymerase used can faithfully add the correct sequence when only one dNTP exists in the reaction system. Paired dNTPs must not have 3'-5' exo-activity or mismatch. It is found in pra...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6816C12Q1/34
CPCC12Q1/34C12Q1/6816G01N2333/922C12Q2563/107C12Q2521/101
Inventor王静静章文蔚陈奥徐崇钧龚梅花罗银铃罗宇芬李长英
OwnerMGI TECH CO LTD



