Method for rapid detection and screening of dna polymerases capable of polymerizing specially constructed dntp

A technology of polymerase and DNA molecules, which is applied in biochemical equipment and methods, measuring devices, measurement/inspection of microorganisms, etc., can solve the problems of inaccurate test results, influence, and inability to use DNA polymerase, etc., to avoid radioactive contamination , wide application range, easy to achieve effect

CN109652500BActive Publication Date: 2021-12-14MGI TECH CO LTD
5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Publication Date
2021-12-14

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses a method for rapid detection and screening of DNA polymerases capable of polymerizing dNTPs with special structures. The present invention provides a method for detecting whether a DNA polymerase to be tested can polymerize dNTPs of a specific structure, comprising the following steps: 1) preparing a single-stranded DNA molecule and a hybrid single-strand complementary to it; In the 3' direction, the adjacent base B and base A are arranged in sequence; 2) The single-stranded DNA molecule, the hybrid single-stranded, the specific structure dNTP and the DNA polymerase to be tested are placed in the system DNA polymerization reaction was carried out in the test to check whether the polymerization was successful. The detection method of the invention has the following advantages: wide application range, no pollution, feasibility, flexible flux, and high flux.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention belongs to the field of biotechnology, in particular to a method for rapidly detecting and screening DNA polymerase capable of polymerizing dNTP with special structure. Background technique

[0002] With the continuous development of sequencing technology, the structure of the dNTP used has been continuously modified: the 3'-OH of the dNTP used in the sequencing-by-synthesis technology is blocked by a cleavable blocking group, and an optional block is added to the base. The excised fluorophore; the dNTP used in PacBio's single-molecule sequencing is 3'-OH free but the 5'-phosphate group is modified with a fluorophore; and some new dNTP molecules continue to be developed and applied in sequencing technology. All of these require DNA polymerase to undergo corresponding changes in order to continue to perform the polymerization function. Indeed, DNA polymerases are already a decisive factor in sequencing technology. Therefore, it is necess...

Examples

Embodiment 1

[0052] Example 1. Establishment of a method for detecting a DNA polymerase with a special structure dNTP

[0053] The present invention uses nucleic acid sequences immobilized on a solid phase, such as DNB loaded on a chip or nucleic acid sequences immobilized using streptavidin and biotin or nucleic acid sequences immobilized on a chip using other methods.

[0054] 1. Method for detecting DNA polymerase for polymerizing fluorescently modified dNTPs

[0055] Fluorescently modified dNTP means that the fluorescent group is connected to the base or 3'-hydroxyl of the dNTP, that is, after the polymerization of DNA polymerase, the fluorescent group will not fall off. Polymerized DNA polymerase ( figure 1 shown), as follows:

[0056] One-step method, as follows:

[0057] 1. Preparation of 10-200nt single-stranded DNA molecules and their complementary hybrid single strands;

[0058] The single-stranded DNA molecule of 10-200nt is preferably a single-stranded DNA molecule of 15-15...

Embodiment 2

[0099] Embodiment 2, the method for detecting the DNA polymerase that is used for polymerizing fluorescently modified dNTP

[0100] This example is carried out on nucleic acid sequences immobilized on chips.

[0101] The equipment used in this embodiment: Bgiseq1000 sequencer (BGI), sequencing chip (BGI), VWR heating plate, PCR instrument, PCR eight tubes.

[0102] The reagents used in this example are shown in Table 1 below.

[0103] Table 1 Reagents and chips

[0104]

[0105]

[0106] 1. Single-stranded DNA molecule and its complementary hybrid single-stranded

[0107] A 45nt single-stranded DNA molecule was designed and synthesized according to the method in Example 1-.

[0108] The 45nt single-stranded DNA molecule is as follows:

[0109] 5 Biotin-AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTGCAT (SEQ ID NO: 1). There are four types of specific structure dNTPs:

[0110] The fluorescently modified dNTP is dATP-Cy3, base A and base B are the 13th and 12th positions ...

Embodiment 3

[0139] Embodiment 3, the method for detecting the DNA polymerase that is used for polymerizing the dNTP that does not have fluorescent modification and 3' end is free

[0140] This example is carried out on nucleic acid sequences immobilized on chips.

[0141] The reagents used in this example are shown in Table 7 below.

[0142] Table 7 Reagents

[0143]

[0144]

[0145] 1. Preparation of single-stranded DNA molecules and complementary hybridization of single-stranded DNA molecules

[0146] According to the second method of embodiment 1, design and synthesize the single-stranded DNA molecule of 45nt:

[0147] The 45nt single-stranded DNA molecule is as follows:

[0148] 5'-BiotinAAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTGCAT (SEQ ID NO: 1).

[0149] The hybrid single-stranded sequence is as follows 153_CAtG: CAACTCCTTGGCTCACAGAACGACA (SEQ ID NO: 3)

[0150] The fluorescently modified dNTP is dGTP-Cy5, and base A, base B and base C are the 18th, 17th and 16th positi...