Method for rapid detection and screening of dna polymerases capable of polymerizing specially constructed dntp
A technology of polymerase and DNA molecules, which is applied in biochemical equipment and methods, measuring devices, measurement/inspection of microorganisms, etc., can solve the problems of inaccurate test results, influence, and inability to use DNA polymerase, etc., to avoid radioactive contamination , wide application range, easy to achieve effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1. Establishment of a method for detecting a DNA polymerase with a special structure dNTP
[0053] The present invention uses nucleic acid sequences immobilized on a solid phase, such as DNB loaded on a chip or nucleic acid sequences immobilized using streptavidin and biotin or nucleic acid sequences immobilized on a chip using other methods.
[0054] 1. Method for detecting DNA polymerase for polymerizing fluorescently modified dNTPs
[0055] Fluorescently modified dNTP means that the fluorescent group is connected to the base or 3'-hydroxyl of the dNTP, that is, after the polymerization of DNA polymerase, the fluorescent group will not fall off. Polymerized DNA polymerase ( figure 1 shown), as follows:
[0056] One-step method, as follows:
[0057] 1. Preparation of 10-200nt single-stranded DNA molecules and their complementary hybrid single strands;
[0058] The single-stranded DNA molecule of 10-200nt is preferably a single-stranded DNA molecule of 15-15...
Embodiment 2
[0099] Embodiment 2, the method for detecting the DNA polymerase that is used for polymerizing fluorescently modified dNTP
[0100] This example is carried out on nucleic acid sequences immobilized on chips.
[0101] The equipment used in this embodiment: Bgiseq1000 sequencer (BGI), sequencing chip (BGI), VWR heating plate, PCR instrument, PCR eight tubes.
[0102] The reagents used in this example are shown in Table 1 below.
[0103] Table 1 Reagents and chips
[0104]
[0105]
[0106] 1. Single-stranded DNA molecule and its complementary hybrid single-stranded
[0107] A 45nt single-stranded DNA molecule was designed and synthesized according to the method in Example 1-.
[0108] The 45nt single-stranded DNA molecule is as follows:
[0109] 5 Biotin-AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTGCAT (SEQ ID NO: 1). There are four types of specific structure dNTPs:
[0110] The fluorescently modified dNTP is dATP-Cy3, base A and base B are the 13th and 12th positions ...
Embodiment 3
[0139] Embodiment 3, the method for detecting the DNA polymerase that is used for polymerizing the dNTP that does not have fluorescent modification and 3' end is free
[0140] This example is carried out on nucleic acid sequences immobilized on chips.
[0141] The reagents used in this example are shown in Table 7 below.
[0142] Table 7 Reagents
[0143]
[0144]
[0145] 1. Preparation of single-stranded DNA molecules and complementary hybridization of single-stranded DNA molecules
[0146] According to the second method of embodiment 1, design and synthesize the single-stranded DNA molecule of 45nt:
[0147] The 45nt single-stranded DNA molecule is as follows:
[0148] 5'-BiotinAAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTGCAT (SEQ ID NO: 1).
[0149] The hybrid single-stranded sequence is as follows 153_CAtG: CAACTCCTTGGCTCACAGAACGACA (SEQ ID NO: 3)
[0150] The fluorescently modified dNTP is dGTP-Cy5, and base A, base B and base C are the 18th, 17th and 16th positi...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com