Heavy immunodeficiency pig model and construction method and application thereof

A technology of immunodeficiency and construction method, which is applied in the field of severe immunodeficiency pig model and its construction, and achieves high safety effect

Pending Publication Date: 2019-05-21
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report of using the BE3 point mutation tool to knock out related genes to obtain immunodeficiency pigs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heavy immunodeficiency pig model and construction method and application thereof
  • Heavy immunodeficiency pig model and construction method and application thereof
  • Heavy immunodeficiency pig model and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] By searching the pig RAG1 (NM_001123184.1), RAG2 (NM_001128481.1) and IL2RG (NM_214083.2) gene sequences in the NCBI database, screen the corresponding gRNA sites: RAG1gRNA, GGAGCAATCTCCAGCAGTCC; RAG2gRNA, GTCACTACAGATGATAACAGT; IL2RGgRNA, GTCCAGACCT, see CCAGG figure 1 ;

[0069] The gRNA sequence was connected to the U6-CAS9 gRNA backbone vector, and the plasmid with the correct sequence identification and the APO-nCas9-UGI plasmid were electrotransferred into pig fetal fibroblasts. A total of 204 single clones were screened. The identification results and editing efficiency are shown in Table 1 and Table 2:

[0070] Table 1

[0071] serial number

RAG1

RAG2

IL2RG

#22

double knock

single tap

double knock

#29

-

-

single tap

#56

-

single tap

single tap

#101

single tap

single tap

double knock

#108

single tap

double knock

double knock

#148

-

-

doubl...

Embodiment 2

[0075] The cells screened in Example 1 were used as somatic cell nuclear transfer donors, transplanted into enucleated oocytes, and transplanted into surrogate sows to obtain 5 cloned pigs, see figure 2 ;

[0076] The genotype identification of 5 cloned pigs is as follows: image 3 , where A632-1 and A632-2 are the double knockout phenotype of RAG gene and IL2RG gene, A632-3 is the single knockout heterozygous phenotype of RAG gene and IL2RG gene, and A633-1 and A633-2 are single knockout of IL2RG gene Pure and phenotype.

Embodiment 3

[0078] The phenotypes of the cloned pigs were identified separately, and the peripheral blood of the cloned pigs was used to detect T, B and NK cells by flow cytometry. CD3 was used to mark T cells, IgM was used to mark B cells, and CD3 and CD8 were used to mark NK cells. The results are shown in Figure 4 , Figure 5 with Image 6 ; compared with wild-type controls, cloned pigs were significantly absent of T, B and NK cells,

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a heavy immunodeficiency pig model and a construction method and application thereof. The method utilizes a BE3 point mutation tool for knocking out RAG1, RAG2 and IL2RG genes to obtain an immunodeficiency models; due to the C mutation T point mutation tool, the multi-gene knockout immunodeficiency model is obtained, the safety is better, the immunodeficiency degree is higher, T cells, B cells and NK cells are completely lost, follow-up application research is facilitated, the construction method is simple and efficiency, and the wide application prospect and huge marketvalue are achieved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a severe immunodeficiency pig model and its construction method and application. Background technique [0002] Immunodeficient mice have played an important role in the fields of biomedicine and basic research, but due to the large differences between mice and humans, some false positive or false negative experimental results are often obtained on mice, which severely limits Application to immunodeficient mice. Compared with mice, pigs have more similarities with humans, including body size, physiological metabolic level, and immune system, so establishing an immunodeficiency pig model has more important practical significance. [0003] At present, there are mainly the following types of immunodeficiency pig models: (1) Immunodeficiency pigs are obtained by knocking out the IL2RG gene with a gene targeting vector. RAG1 / 2 gene, this model shows the loss of T cells and B cells, and nor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12N15/90A01K67/027
Inventor赖良学王可品葛维凯刘琪帅谢精科
OwnerGUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI