Heavy immunodeficiency pig model and construction method and application thereof
A technology of immunodeficiency and construction method, which is applied in the field of severe immunodeficiency pig model and its construction, and achieves high safety effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] By searching the pig RAG1 (NM_001123184.1), RAG2 (NM_001128481.1) and IL2RG (NM_214083.2) gene sequences in the NCBI database, screen the corresponding gRNA sites: RAG1gRNA, GGAGCAATCTCCAGCAGTCC; RAG2gRNA, GTCACTACAGATGATAACAGT; IL2RGgRNA, GTCCAGACCT, see CCAGG figure 1 ;
[0069] The gRNA sequence was connected to the U6-CAS9 gRNA backbone vector, and the plasmid with the correct sequence identification and the APO-nCas9-UGI plasmid were electrotransferred into pig fetal fibroblasts. A total of 204 single clones were screened. The identification results and editing efficiency are shown in Table 1 and Table 2:
[0070] Table 1
[0071] serial number
RAG1
RAG2
IL2RG
#22
double knock
single tap
double knock
#29
-
-
single tap
#56
-
single tap
single tap
#101
single tap
single tap
double knock
#108
single tap
double knock
double knock
#148
-
-
doubl...
Embodiment 2
[0075] The cells screened in Example 1 were used as somatic cell nuclear transfer donors, transplanted into enucleated oocytes, and transplanted into surrogate sows to obtain 5 cloned pigs, see figure 2 ;
[0076] The genotype identification of 5 cloned pigs is as follows: image 3 , where A632-1 and A632-2 are the double knockout phenotype of RAG gene and IL2RG gene, A632-3 is the single knockout heterozygous phenotype of RAG gene and IL2RG gene, and A633-1 and A633-2 are single knockout of IL2RG gene Pure and phenotype.
Embodiment 3
[0078] The phenotypes of the cloned pigs were identified separately, and the peripheral blood of the cloned pigs was used to detect T, B and NK cells by flow cytometry. CD3 was used to mark T cells, IgM was used to mark B cells, and CD3 and CD8 were used to mark NK cells. The results are shown in Figure 4 , Figure 5 with Image 6 ; compared with wild-type controls, cloned pigs were significantly absent of T, B and NK cells,
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com