Biological compound for treating cancer, and preparation method and application of biological compound
A biological compound and cancer technology, which is applied in the direction of drug combination, medical preparations of non-active ingredients, pharmaceutical formulas, etc., can solve problems such as radiation reaction damage, achieve the effects of reducing damage, simplifying synthesis steps, and reducing biological toxicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 A biological compound for treating cancer
[0036] This embodiment is a radioactive isotope-labeled DNA fragment, which can be directly targeted and introduced into cancer cells without packaging. The nucleic acid sequence of the DNA fragment is:
[0037] 5'-
[0038] ACTCCAGTAAACCCTGGTGTTGGCCAGTGCTGCACTTCTTCATATGCCAACAGGAGGCCATGCTTCAGCAGCTTGGTGGTGGATGAAACATATGTCCCTCCTGCATTCTCTGATGACAAGTTCATTTTCCATAAGGATCTGTGCCAAGCTCAG-3'.
[0039] The above nucleotide sequences are artificially synthesized sequences or selected from human cell genomic DNA.
Embodiment 2
[0040] Example 2 A preparation method of a biological compound for treating cancer
[0041] This embodiment is carried out in two steps, that is, PCR amplification and labeling of radioactive isotopes, and G50 gel column chromatography.
[0042] The specific operation steps are:
[0043] (1) PCR amplification and labeling with radioactive isotopes
[0044] The primer sequences for PCR amplification are:
[0045] Upstream primer: 5'-ACTCCAGTAAACCCTGGTGTTG-3',
[0046] Downstream primer: 5'-CTGAGCTTGGCACAGATCCTTATG-3';
[0047] In PCR amplification, the reaction system is 20uL,
[0048] In parts by volume, the components forming the reaction system include:
[0049] 1 part of 50 ng / μL genomic DNA, 2 parts of 10 μM upstream primer, 2 parts of 10 μM downstream primer, 0.4 part of LA Taq DNA polymerase, 5 parts of 10× amplification buffer, 10 mmol / L dTTP 1 part, 10 mmol / L 1 part of dATP; 1 part of 10 mmol / L dGTP, 1 part of 0.1 mmol / L dCTP, 10 parts of isotope-labeled nucleoti...
Embodiment 3
[0052] Embodiment 3 A kind of preparation method of biological compound for treating cancer
[0053] This embodiment is carried out in two steps, that is, PCR amplification and labeling of radioactive isotopes, and G50 gel column chromatography.
[0054] The specific operation steps are:
[0055] (1) PCR amplification and labeling with radioactive isotopes
[0056] The primer sequences for PCR amplification are:
[0057] Upstream primer: 5'-ACTCCAGTAAACCCTGGTGTTG-3',
[0058] Downstream primer: 5'-CTGAGCTTGGCACAGATCCTTATG-3';
[0059] In PCR amplification, the reaction system is 200 uL,
[0060] In parts by volume, the components forming the reaction system include:
[0061] 1 part of 50 ng / μL genomic DNA, 2 parts of 10 μM upstream primer, 2 parts of 10 μM downstream primer, 0.4 part of LA Taq DNA polymerase, 5 parts of 10× amplification buffer, 10 mmol / L dTTP 1 part, 10 mmol / L 1 part of dATP; 1 part of 10 mmol / L dGTP, 1 part of 0.1 mmol / L dCTP, 10 parts of isotope-label...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


