Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Biological compound for treating cancer, and preparation method and application of biological compound

A biological compound and cancer technology, which is applied in the direction of drug combination, medical preparations of non-active ingredients, pharmaceutical formulas, etc., can solve problems such as radiation reaction damage, achieve the effects of reducing damage, simplifying synthesis steps, and reducing biological toxicity

Inactive Publication Date: 2019-06-07
孔彦平
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the process of clinical radiotherapy, radiation will inevitably have a certain impact on normal tissues of the human body, resulting in certain radiation reactions and damage.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological compound for treating cancer, and preparation method and application of biological compound
  • Biological compound for treating cancer, and preparation method and application of biological compound

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 A biological compound for treating cancer

[0036] This embodiment is a radioactive isotope-labeled DNA fragment, which can be directly targeted and introduced into cancer cells without packaging. The nucleic acid sequence of the DNA fragment is:

[0037] 5'-

[0038] ACTCCAGTAAACCCTGGTGTTGGCCAGTGCTGCACTTCTTCATATGCCAACAGGAGGCCATGCTTCAGCAGCTTGGTGGTGGATGAAACATATGTCCCTCCTGCATTCTCTGATGACAAGTTCATTTTCCATAAGGATCTGTGCCAAGCTCAG-3'.

[0039] The above nucleotide sequences are artificially synthesized sequences or selected from human cell genomic DNA.

Embodiment 2

[0040] Example 2 A preparation method of a biological compound for treating cancer

[0041] This embodiment is carried out in two steps, that is, PCR amplification and labeling of radioactive isotopes, and G50 gel column chromatography.

[0042] The specific operation steps are:

[0043] (1) PCR amplification and labeling with radioactive isotopes

[0044] The primer sequences for PCR amplification are:

[0045] Upstream primer: 5'-ACTCCAGTAAACCCTGGTGTTG-3',

[0046] Downstream primer: 5'-CTGAGCTTGGCACAGATCCTTATG-3';

[0047] In PCR amplification, the reaction system is 20uL,

[0048] In parts by volume, the components forming the reaction system include:

[0049] 1 part of 50 ng / μL genomic DNA, 2 parts of 10 μM upstream primer, 2 parts of 10 μM downstream primer, 0.4 part of LA Taq DNA polymerase, 5 parts of 10× amplification buffer, 10 mmol / L dTTP 1 part, 10 mmol / L 1 part of dATP; 1 part of 10 mmol / L dGTP, 1 part of 0.1 mmol / L dCTP, 10 parts of isotope-labeled nucleoti...

Embodiment 3

[0052] Embodiment 3 A kind of preparation method of biological compound for treating cancer

[0053] This embodiment is carried out in two steps, that is, PCR amplification and labeling of radioactive isotopes, and G50 gel column chromatography.

[0054] The specific operation steps are:

[0055] (1) PCR amplification and labeling with radioactive isotopes

[0056] The primer sequences for PCR amplification are:

[0057] Upstream primer: 5'-ACTCCAGTAAACCCTGGTGTTG-3',

[0058] Downstream primer: 5'-CTGAGCTTGGCACAGATCCTTATG-3';

[0059] In PCR amplification, the reaction system is 200 uL,

[0060] In parts by volume, the components forming the reaction system include:

[0061] 1 part of 50 ng / μL genomic DNA, 2 parts of 10 μM upstream primer, 2 parts of 10 μM downstream primer, 0.4 part of LA Taq DNA polymerase, 5 parts of 10× amplification buffer, 10 mmol / L dTTP 1 part, 10 mmol / L 1 part of dATP; 1 part of 10 mmol / L dGTP, 1 part of 0.1 mmol / L dCTP, 10 parts of isotope-label...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a biological compound for treating cancer, and a preparation method and application of the biological compound. The biological compound is a radioactive isotope labelled DNA fragment. The preparation method of the biological compound for treating cancer comprises two steps of performing PCR amplification and labelling radioactive isotope and performing G50 gel column chromatography. The preparation method is simple. According to the biological compound for treating cancer, the radioactive isotope can be directly guided into cancer cells in a targeted manner without packaging, and the purpose of treating the cancer without damaging the normal tissue of a human body can be achieved, and the biological compound is suitable for treating primary lesion of the cancer, ortransferred cancer, primary liver cancer and late stage cancer.

Description

technical field [0001] The invention belongs to the field of pharmaceutical preparations, and relates to a substance for treating cancer, in particular to a biological compound for treating cancer, its preparation method and application. Background technique [0002] In medicine, cancer refers to a malignant tumor originating from epithelial tissue, which has biological characteristics such as abnormal cell differentiation and proliferation, uncontrolled growth, invasion and metastasis, and is a kind of chronic disease with relatively high difficulty in treatment. The number one cause of death among urban and rural residents. [0003] The current cancer treatment methods include surgery, chemotherapy, radiotherapy, etc., but there are certain defects. For example, although surgery is the best treatment for early cancer, early diagnosis of cancer is difficult. Many patients have entered the middle and late stages of cancer when they are diagnosed, and surgery has failed; che...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K51/04A61K47/26A61P35/00A61K101/00
Inventor 孔彦平刘锦红
Owner 孔彦平
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com