Scn9a antisense oligonucleotides

A peptide nucleic acid and nucleobase technology, applied in the field of peptide nucleic acid derivatives, can solve the problems of unreported alternative splicing and achieve high binding affinity

Active Publication Date: 2019-07-09
OLIPASS CORP
View PDF13 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0047] Antisense inhibition of SCN9A pre-mRNA splicing: To date, no instances of SCN9A ASO-induced alternative splicing of SCN9A pre-mRNA have been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Scn9a antisense oligonucleotides
  • Scn9a antisense oligonucleotides
  • Scn9a antisense oligonucleotides

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0285] Example 1. Exon skipping induced by "ASO 9" in PC3 cells

[0286] 'ASO9' and [(5'→3')CGUCA spanning the junction of 'exon 4' and 'intron 4' in the human SCN9A pre-mRNA UUGUUUUUGC ┃ guaagu The 16-mer pre-mRNA sequences marked "bold" and "underlined" in the 30-mer sequence of acuuucagc] are complementary bound. "ASO 9" has a 10-mer overlap with "Exon 4" and a 6-mer overlap with "Intron 4". Thus, "ASO 9" satisfies the complementarity overlap criterion for compounds of formula I of the present invention.

[0287] Given the known high expression of human SCN9A mRNA in PC3 cells [ Br. J. Pharmacol vol 156, 420-431 (2009)], the ability of "ASO 9" to induce "exon 4" skipping of human SCN9A pre-mRNA in PC3 cells was assessed by SCN9A nested RT-PCR as described below.

[0288] [Cell culture and ASO treatment] Make PC3 cells (Cat. No. CRL-1435, ATCC) in 5 mL of Ham's F-12K medium supplemented with 10% FBS, 1% streptomycin / penicillin, 1% L-glutamine amide and 1% sodium pyru...

Embodiment 2

[0293] Example 2. qPCR of SCN9A mRNA in PC3 cells treated with "ASO 9"

[0294] The ability of "ASO 9" to induce changes in the expression level of human SCN9A mRNA in PC3 cells was assessed by qPCR against an exon-specific primer set covering "Exons 4-6" as follows.

[0295] [Cell culture and ASO treatment] PC3 cells grown in a 60 mm dish containing 5 mL of F-12K medium were incubated with "ASO 9" at 0 (negative control), 10, 100 or 1000 zM for 24 hours. (2 Petri dishes for each ASO concentration).

[0296] [RNA Extraction] Using "MiniBEST Universal RNA Extraction Kit" (Cat. No. 9767, Takara), total RNA was extracted according to the manufacturer's instructions.

[0297] [Synthesis of cDNA by one-step RT-PCR] Using Super Script ® One-Step RT-PCR Kit and Platinum ® Taq polymerase (Catalog No. 10928-042, Invitrogen) and a set of exon-specific primers [exon 2_forward: (5'→3') CTTTCTCCTTTCAGTCCTCT; and exon 9_reverse: ( 5'→3')TTGCCTGGTTCTGTTCTT], according to the following cy...

Embodiment 3

[0300] Example 3. Inhibition of sodium current in PC3 cells treated with "ASO 9"

[0301] Cellular sodium currents are usually measured by patch clamp. As sodium ions enter cells, intracellular sodium ion levels increase. Intracellular sodium levels can be detected using sodium ion-sensitive dyes. "CoroNa Green" is a dye with a crown ether type sodium ion chelating agent. "CoroNa Green" emits green fluorescence when it chelates sodium ions. "CoroNa Green" has been used to indirectly measure intracellular sodium levels. Sodium levels measured by "CoroNa Green" were found to correlate well with sodium ion currents measured by sodium ion patch clamp[ Proc. Natl. Acad. Sci. USA vol 106(38), 16145-16150 (2009)].

[0302] PC3 cells are known to express abundant human SCN9A mRNA and sodium currents, despite co-expressing other SCN isoforms[ Br. J. Pharmacol . vol 156, 420-431 (2009)]. Therefore, if Na v The sodium ion current of 1.7 sodium channel subtypes accounts for a si...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
fluorescenceaaaaaaaaaa
fluorescenceaaaaaaaaaa
Login to View More

Abstract

The invention provides peptide nucleic acid derivatives targeting a part of the human SCN9A pre-mRNA. The peptide nucleic acid derivatives potently induce splice variants of the SCN9A mRNA in cells, and are useful to safely treat pains or conditions involving Nav1.7 activity.

Description

[0001] The present invention relates to peptide nucleic acid derivatives targeting SCN9A pre-mRNA for the treatment of v 1.7 Subtype-Mediated Pain and Disorders, and Claims Benefit of Priority to US Provisional Application No. 62 / 395814, filed September 16, 2016, which is hereby incorporated by reference in its entirety. [0002] Background of the invention [0003] Voltage-gated sodium channels (VGSCs) are transmembrane proteins composed of α and β subunits. VGSCs function as channels for sodium ions across the cell membrane. Sodium channel activity is produced by the α-subunit. VGSC subtypes are defined according to subtypes of the α-subunit. To date, at least 10 subtypes of VGSC, the Na v 1.1, Na v 1.2,...,Na v 1.9 and Na x . [0004] Each VGSC subtype has a distinct α subunit and is destined to display biological functions according to the tissue in which it is expressed. For example, Na v The 1.2 subtype is expressed in central neurons. Na v 1.2 Appears to be as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/00C07K7/08C12N15/113A61K38/00
CPCA61K38/00C12N15/113C12N2310/3181C07K14/003A61P25/02A61P25/00C12N2310/333C12N2310/336Y02P20/55C07K7/08A61K38/10A61K38/16A61P25/04
Inventor郑信郑多览曹峰准张降愿尹兴植
OwnerOLIPASS CORP