Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction method and application of maize dwarf disease induced gene p3a and its genetic transformation system

A genetic transformation system and a technology for dwarfing disease, applied in the field of genetic engineering, can solve problems such as affecting the yield and quality of corn, yellowing, and corn dwarfing.

Active Publication Date: 2021-01-01
INST OF TOBACCO ANHUI ACADEMY OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] An article entitled "Characterization of a Novel Polerovirus Infecting Maize in China" published by Sha Chen et al. in Viruses magazine in 2016 disclosed a new type of virus - Maize Yellow Mosaic Virus MaYMV, which infects corn Causes dwarfing and yellowing symptoms of corn, which seriously affects the yield and quality of corn

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of maize dwarf disease induced gene p3a and its genetic transformation system
  • Construction method and application of maize dwarf disease induced gene p3a and its genetic transformation system
  • Construction method and application of maize dwarf disease induced gene p3a and its genetic transformation system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] 1. Materials

[0031] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are all commercially available products unless otherwise specified.

[0032] 2. Method

[0033] 2.1 RNA Extraction of Maize Yellow Mosaic Virus Strain

[0034] Live corn plants infected with corn yellow mosaic virus were taken, and the total RNA of leaves of infected plants was extracted using an RNA extraction kit, and the RNA was reverse-transcribed into cDNA.

[0035] 2.2 Cloning of maize dwarf disease induced gene P3a

[0036] Use primers F: CATACCATTTACGAACGATAGGTCGACATACAGAAGCTTCGAAGATAGC and R: GTCGTGGTCCTTATAGTCGTCGACCCTCCCGTATTCATTCACAAT to amplify P3a gene with cDNA as a template, connect the amplified P3a gene to pUC19-2X35S-3XFLAG vector with Flag tag, and construct plant expression with Flag tag The carrier was sent to Shanghai Sangon Bioengineering Technology Service Co., ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a maize dwarf disease induction gene P3a, a construction method for a genetic transformation system thereof, and applications, and belongs to the technical field of gene engineering. The maize dwarf disease induction gene P3a has a nucleotide sequence shown as SEQ ID NO. 1; and a genetic transformation system of the maize dwarf disease induction gene P3a can induce maize plants to dwarf, which shows that the gene is a key gene inducing maize dwarf diseases. Through the discovery of the gene, blanks of pathogenic mechanism research on the maize dwarf diseases can be filled up, and theoretical bases can be provided for later research on the molecular mechanisms of the maize dwarf diseases.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a construction method and application of a corn dwarf disease inducible gene P3a and a genetic transformation system thereof. Background technique [0002] As one of the crops with the largest planting area in my country, corn is an important economic crop in my country. Corn dwarf disease is a kind of disease caused by insect-borne viruses, including: ①Dwarf plants caused by corn rough dwarf disease, the diseased plants are obviously shorter than normal plants, the leaves are dark green, the leaves are wide, short and thick, and the upper nodes ② In the dwarf plants caused by corn dwarf mosaic disease, only the veins of the leaves of the diseased plants are green, and the rest of the leaves are yellow, showing yellow and green stripes, and the leaf tissue becomes hard, brittle, easy to break. [0003] Corn will suffer from dwarf disease throughout the growth cycle,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/40C12N15/82C12N15/66A01H5/00A01H6/46
CPCC07K14/005C12N15/66C12N15/8283C12N2770/00022
Inventor 王芳董庆周本国许大凤
Owner INST OF TOBACCO ANHUI ACADEMY OF AGRI SCI