Construction method and application of maize dwarf disease induced gene p3a and its genetic transformation system
A genetic transformation system and a technology for dwarfing disease, applied in the field of genetic engineering, can solve problems such as affecting the yield and quality of corn, yellowing, and corn dwarfing.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] 1. Materials
[0031] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are all commercially available products unless otherwise specified.
[0032] 2. Method
[0033] 2.1 RNA Extraction of Maize Yellow Mosaic Virus Strain
[0034] Live corn plants infected with corn yellow mosaic virus were taken, and the total RNA of leaves of infected plants was extracted using an RNA extraction kit, and the RNA was reverse-transcribed into cDNA.
[0035] 2.2 Cloning of maize dwarf disease induced gene P3a
[0036] Use primers F: CATACCATTTACGAACGATAGGTCGACATACAGAAGCTTCGAAGATAGC and R: GTCGTGGTCCTTATAGTCGTCGACCCTCCCGTATTCATTCACAAT to amplify P3a gene with cDNA as a template, connect the amplified P3a gene to pUC19-2X35S-3XFLAG vector with Flag tag, and construct plant expression with Flag tag The carrier was sent to Shanghai Sangon Bioengineering Technology Service Co., ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


