A method for improving the nodulation competition ability of rhizobia usda110

A technology of rhizobia and soybean rhizobia, which is applied in the field of genetic engineering, can solve the problems that the inoculum cannot achieve the expected effect, the nitrogen fixation ability is weak, and the nodulation rate of the inoculated rhizobia can be reduced, so as to improve the ability of competitive nodulation and nitrogen fixation ability, good symbiotic nitrogen fixation and the effect of competitive nodulation

Active Publication Date: 2021-01-08
华创佳农生物科技(武汉)有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

One of the most important reasons is that my country is the country of origin of soybeans, and there are many indigenous rhizobia in the soil. The indigenous rhizobia in the soil have strong competitive ability but weak nitrogen fixation ability, which reduces the nodulation rate of inoculated rhizobia, so that inoculation Bacteria can not achieve the expected effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for improving the nodulation competition ability of rhizobia usda110
  • A method for improving the nodulation competition ability of rhizobia usda110
  • A method for improving the nodulation competition ability of rhizobia usda110

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1 Mutant bacterial strain construction

[0031] According to the genome of the wild-type strain Bradyrhizobium japonicum USDA110, the dgoK1 gene sequence was found in NCBI, the sequence of about 500 bp near the 5' end was selected, the upstream and downstream primers were designed, and appropriate restriction sites were added to obtain the target fragment by PCR. After recovery, the The target fragment was ligated with the T vector (pMD19-T) and sent to the company for sequencing.

[0032] Primer information:

[0033] F: CGGGATCC CCGCCTTGAAGCTTGCAA BamH1

[0034] R: GGAATTCCAGGTCCTGGCCGAACG EcoR1

[0035] Construction of pK19mob insertion inactivation plasmid. The correctly sequenced bacterial plasmid was digested and recovered, and connected to pK19mob. The insertion inactivation plasmid was transformed into E.coli DH5α, the plasmid was extracted, transformed into E.coli S17-1, and introduced into the wild-type bacteria USDA110 through conjugation of two...

Embodiment 2

[0038] Embodiment 2 Pot experiment detects symbiotic nitrogen fixation traits

[0039] (1) Seed treatment: When soybeans are cultivated with sterilized vermiculite, the seeds are sterilized with 75% ethanol for 30 seconds, poured off the ethanol, then sterilized with 5% NaClO for 3 minutes, washed 10 times with sterile water, and spread on 1-2% water agar On a flat plate, cultivate in the dark at 28 degrees for 2 days; when planting with soil as the substrate, the seeds are not sterilized, soaked in water for 1 hour, and planted in the soil.

[0040] (2) Cultivation: Soybeans are planted with vermiculite, sterilized with clean vermiculite for 1 hour, large pots and plates are sterilized by ultraviolet light, filled with vermiculite, 6 pots are placed on each plate, and 3 soybeans are planted in each plate, and no The nitrogen nutrient solution was poured on the plate. If soil is used to plant soybeans, the soil samples are not sterilized and planted directly.

[0041] (3) Rh...

Embodiment 3

[0045] Embodiment 3 Pot experiment detects competition nodulation ability

[0046] 1) Detection of competitive nodulation ability in sterile vermiculite

[0047] ①Williams 82 was planted in sterile vermiculite, and the seed treatment and cultivation methods were the same as those in 2.

[0048] ②Rhizobia inoculation: OD of all bacteria before inoculation 600 Adjusted to 0.5, USDA110 (dgoK mut) and USDA110 (mcherry) were mixed at a ratio of 1:1, 10:1, and 1:10 respectively. After mixing evenly, the plants were inoculated with 2 mL of bacteria.

[0049] ③ Competitive nodulation detection: Harvest plants, remove root nodules, observe with a fluorescence microscope, take pictures, and count non-luminescent nodules, which is the nodule rate of recombinant bacteria.

[0050] The result is as Figure 6 As shown, when 1:1 mixed inoculation, USDA110 (dgoKmut) accounted for tumor rate of 84% greater than 50%, when 1:10 mixed inoculation, USDA110 (dgoKmut) accounted for tumor rate of ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving a competitive nodulation capacity of nodule bacteria USDA110. A dgoK1 singly inserted mutant strain USDA110 (dgoKmut) is constructed through pK19mob, under the soil potting condition, compared with a plant inoculated with USDA110, the fresh weight, nodule number, nodule weight and enzyme activity of a plant inoculated with USDA110 (dgoKmut) are all significantly increased; compared with indigenous nodule bacteria, the competitive nodulation capacity of the USDA110 (dgoKmut) is improved by 24.5%, and can reach 31.8%. Therefore, the USDA110 (dgoKmut) has good symbiotic nitrogen fixation and competitive nodulation capacities, and can be used as a promising strain in field experiments.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a method for improving the nodulation competition ability of rhizobia USDA110. Background technique [0002] China accounts for 8%-10% of the world's arable land, but the use of chemical fertilizers accounts for 35% of the world. Excessive use of chemical fertilizers not only increases the economic burden of farmers, but also seriously damages the natural environment. The fertilizer utilization rate of my country's main food crops is only 20%-35%, while that of developed countries is 40%-50%. At the same time, my country releases more than 20 million tons of nitrogen fertilizer and more than 10 million tons of phosphate fertilizer to the natural environment every year. Excessive use of nitrogen fertilizers has caused surface and groundwater pollution and soil acidification. We must pay attention to environmental pollution caused by excessive use of chemi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/74C12R1/01
CPCC07K14/195C12N15/74
Inventor李友国胡倡杜倩
Owner华创佳农生物科技(武汉)有限公司