Application of bluegrass semi-cryptic virus as vigs vector
A virus and precocious technology, which is applied in the application field of Poa annua semi-latent virus as VIGS carrier, can solve the problems of loss of target gene fragments, restricted application, severe symptoms, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1 Construction of the gene silencing vector system based on bluegrass semi-latent virus
[0055] In this example, the symptoms caused by PSLV infection of barley, wheat and millet are mild, indicating that PSLV has the potential to be developed into a VIGS vector.
[0056] (1) Construction of recombinant vector
[0057] 1. Design primers F1 and R1 and submit them to Invitrogen for synthesis. The sequence of the primers is (5'-3'):
[0058] F1: ggtattcgagagagagttcgcgggctcattg;
[0059] R1: TGGTCTTCCTTGGAGGACCGAAGCTGAGCTTCGG;
[0060] Using the cDNA of the PSLV genome as a template, the above-mentioned F1 and R1 primers were used to amplify the full-length α-chain of PSLV, and its nucleotide sequence is shown in SEQ ID NO:3.
[0061] 2. Design primers F2 and R2 and submit them to Invitrogen for synthesis. The sequence of the primers is (5'-3'):
[0062] F2: gctcagcttcggtcctccaaggaagaccaCTCGAGGTCGACGGTATCGATAAG;
[0063] R2: gcccgcgaactctctctcgaataccTATAGTGAGT...
Embodiment 2
[0100] Embodiment 2 gene silencing carrier system can infect barley, wheat and millet
[0101] This experimental example is used to illustrate that the gene silencing vector system constructed in Example 1 can infect barley, wheat and millet, and cause mild symptoms.
[0102] The PSLVα, β and γ transcribed in vitro were mixed in an equimolar ratio, and rubbed to inoculate barley and wheat at the two-leaf stage. At 15 days, compared with the control, mild symptoms were observed on the systematic leaves of barley and wheat inoculated with PSLV, and it was proved by Western blot that PSLV CP exists in the systematic leaves of barley and wheat, indicating that PSLV can invade Dyed barley and wheat ( Figure 4 ).
[0103] Collect wheat leaves infected by PSLV, add a certain volume of 20mM phosphoric acid buffer (pH 7.2), and grind them evenly with a mortar. Dip the juice and rub to inoculate millet at the two-leaf or three-leaf stage. 18 days after inoculation, Western blot det...
Embodiment 3
[0104] Example 3 Construction and application of the gene silencing vector system based on Poa annua semi-cryptic virus
[0105] This example uses the PDS gene of benthamiana barley as the target gene to illustrate the construction and application of a gene silencing vector system based on Poa annua semi-cryptic virus.
[0106] (1) Construction of gene silencing vector system
[0107] 1. Design primers F8 and R8 and submit them to Invitrogen for synthesis. The sequence of the primers is (5'-3'):
[0108] F8: AGGCCTCTGCAGTCAGAGTTTTACTTAGTTTGAAAAAATCC;
[0109] R8: CATATGAGTACTTTTAATTATCAAAACCCAAAAAG;
[0110] Using the above pT7-PSLVγ as a template, use the above primers to carry out reverse PCR, then treat with T4PNK kinase produced by NEB company and self-ligate, so as to circularize the linearized product of reverse PCR, and finally stop the codon at the γb of pT7-PSLVγ Restriction sites Pst I, Stu I and Nde I were added downstream, and the product was called pT7-PSLVγM...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap