Application of bluegrass semi-cryptic virus as vigs vector

A virus and precocious technology, which is applied in the application field of Poa annua semi-latent virus as VIGS carrier, can solve the problems of loss of target gene fragments, restricted application, severe symptoms, etc.

Active Publication Date: 2021-05-14
CHINA AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

A common problem is that symptoms following viral infection often interfere with the observation of target gene silencing phenotypes
After some viruses such as BMV integrate the target gene, the target gene fragment will often be lost during the process of infecting the host, so that the target gene cannot be continuously silenced in the whole plant
In addition, some viruses such as BSMV itself can trigger a certain disease resistance response after infecting the host, which limits its application in studying the function of some specific pathway genes such as disease resistance genes
Although the above seven viruses have been developed into VIGS vectors, for some specific economic crops such as millet, the only available VIGS tool is FoMV, and the symptoms of FoMV on millet are relatively severe

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of bluegrass semi-cryptic virus as vigs vector
  • Application of bluegrass semi-cryptic virus as vigs vector
  • Application of bluegrass semi-cryptic virus as vigs vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1 Construction of the gene silencing vector system based on bluegrass semi-latent virus

[0055] In this example, the symptoms caused by PSLV infection of barley, wheat and millet are mild, indicating that PSLV has the potential to be developed into a VIGS vector.

[0056] (1) Construction of recombinant vector

[0057] 1. Design primers F1 and R1 and submit them to Invitrogen for synthesis. The sequence of the primers is (5'-3'):

[0058] F1: ggtattcgagagagagttcgcgggctcattg;

[0059] R1: TGGTCTTCCTTGGAGGACCGAAGCTGAGCTTCGG;

[0060] Using the cDNA of the PSLV genome as a template, the above-mentioned F1 and R1 primers were used to amplify the full-length α-chain of PSLV, and its nucleotide sequence is shown in SEQ ID NO:3.

[0061] 2. Design primers F2 and R2 and submit them to Invitrogen for synthesis. The sequence of the primers is (5'-3'):

[0062] F2: gctcagcttcggtcctccaaggaagaccaCTCGAGGTCGACGGTATCGATAAG;

[0063] R2: gcccgcgaactctctctcgaataccTATAGTGAGT...

Embodiment 2

[0100] Embodiment 2 gene silencing carrier system can infect barley, wheat and millet

[0101] This experimental example is used to illustrate that the gene silencing vector system constructed in Example 1 can infect barley, wheat and millet, and cause mild symptoms.

[0102] The PSLVα, β and γ transcribed in vitro were mixed in an equimolar ratio, and rubbed to inoculate barley and wheat at the two-leaf stage. At 15 days, compared with the control, mild symptoms were observed on the systematic leaves of barley and wheat inoculated with PSLV, and it was proved by Western blot that PSLV CP exists in the systematic leaves of barley and wheat, indicating that PSLV can invade Dyed barley and wheat ( Figure 4 ).

[0103] Collect wheat leaves infected by PSLV, add a certain volume of 20mM phosphoric acid buffer (pH 7.2), and grind them evenly with a mortar. Dip the juice and rub to inoculate millet at the two-leaf or three-leaf stage. 18 days after inoculation, Western blot det...

Embodiment 3

[0104] Example 3 Construction and application of the gene silencing vector system based on Poa annua semi-cryptic virus

[0105] This example uses the PDS gene of benthamiana barley as the target gene to illustrate the construction and application of a gene silencing vector system based on Poa annua semi-cryptic virus.

[0106] (1) Construction of gene silencing vector system

[0107] 1. Design primers F8 and R8 and submit them to Invitrogen for synthesis. The sequence of the primers is (5'-3'):

[0108] F8: AGGCCTCTGCAGTCAGAGTTTTACTTAGTTTGAAAAAATCC;

[0109] R8: CATATGAGTACTTTTAATTATCAAAACCCAAAAAG;

[0110] Using the above pT7-PSLVγ as a template, use the above primers to carry out reverse PCR, then treat with T4PNK kinase produced by NEB company and self-ligate, so as to circularize the linearized product of reverse PCR, and finally stop the codon at the γb of ​​pT7-PSLVγ Restriction sites Pst I, Stu I and Nde I were added downstream, and the product was called pT7-PSLVγM...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the application of the bluegrass semi-cryptic virus as a VIGS carrier. The gene silencing vector system includes a plasmid containing the expression cassettes of Poa annua semilatent virus RNAα, RNAβ and RNAγ; wherein, RNAα, RNAβ and RNAγ are respectively located in different expression cassettes, and these expression cassettes are located on the same plasmid or on different plasmids; The RNAγ expression cassette also contains a target sequence, and the target sequence is located at the 3′ end of the γb protein coding gene in the RNAγ. The gene silencing carrier system based on the bluegrass semi-latent virus of the present invention can efficiently silence the genes of the genomes of monocotyledonous plants such as millet.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of bluegrass semi-cryptic virus as a VIGS carrier. Background technique [0002] Virus-induced gene silencing (VIGS) vectors provide a powerful tool for functional genomics research. Before the emergence of VIGS technology, the function of a certain gene mostly relied on traditional genetic transformation methods. Generally, T-DNA or transposons were randomly inserted into the genome of plants to obtain a large number of mutants, and the target gene was obtained by screening. Knock-out (knock-out) mutants, and then by observing the phenotypic changes of the mutants to determine the function of the target gene. This method can completely inactivate the target gene and has a good effect, but this method also has obvious disadvantages. It not only requires genetic transformation, but also needs to screen the target mutant, which is complicated and time-consu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/83C12N15/29A01H5/00A01H6/46
CPCC12N15/8218
Inventor张永亮李召雷李大伟胡佳成姜志豪于嘉林王献兵韩成贵王颖
OwnerCHINA AGRI UNIV