Application of rice long-chain small RNA

A rice, sheath blight technology, applied in the direction of application, DNA / RNA fragments, recombinant DNA technology, etc., can solve problems affecting rice resistance and other issues

Active Publication Date: 2020-12-08
NANJING AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the regulation of OsTCP21 mediated by miR319 may affect the resistance of rice to the infection of Magnaporthe grisea and rice tooth dwarf virus RRSV by manipulating the jasmonate JA signaling pathway

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of rice long-chain small RNA
  • Application of rice long-chain small RNA
  • Application of rice long-chain small RNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] The construction of embodiment 1 transgenic plant

[0015] 1) Construction of Artificial sRNA vector: Use the online software WMD3 (http: / / wmd3.weigelworld.org) to design the required Artificial sRNA primers (select pNW55 vector for transgenic rice):

[0016] I miR-s:agAGATGAGCTCAACGAGAACAGAAATCTCGTGTGcaggagattcagtttga;

[0017] II miR-a:tgCACACGAGATTTCTGTTCTCGTTGAGCTCATCTctgctgctgctacagcc;

[0018] III miR*s: ctCACACCAGAATTCTGTTCTCGTTGAGCTCATCTttcctgctgctaggctg;

[0019] IV miR*a:aaAGATGAGCTCAACGAGAACAGAATTCTGGTGTGagagaggcaaaagtgaa;

[0020] and universal primers

[0021] G-4368:CTGCAAGGCGATTAAGTTGGGTAAC;

[0022] G-4369: GCGGATAACAATTTCACACAGGAAACAG;

[0023] Using the pNW55 vector as a template, a common PCR system was used to clone the miRNA template vector. The PCR protocol is as follows:

[0024] Modified PCR of pNW55:

[0025]

[0026] Mix all PCR products from modified PCR for fusion PCR:

[0027]

[0028] 2) Use the gateway system to construc...

Embodiment 2

[0033]1. Inoculate 4-week-old wild-type rice with sheath blight bacteria, take rice samples 1 day after infection and extract the total RNA, and then use qRT-PCR and northern blotting to detect the expression of wild-type rice lsiR59604. It was found that rice sheath blight infection can significantly induce the expression of rice lsiR59604 ( figure 1 ).

[0034] qRT-PCR: detection of lsiR59604 by stem-loop method. The required primers are as follows:

[0035] lsiR59604 stem-loop: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACACG

[0036] lsiR59604-F: agCCCGAGATGAGCTCAACGAGAACAGAAATCT

[0037] q-GR: CAGTGCAGGGTCCGAGGTAT

[0038] The extracted total RNA was reverse-transcribed with the specific primer lsiR59604 stem-loop, and then amplified with lsiR59604-F and q-GR.

[0039] northern blotting

[0040] (1) Sample loading:

[0041] a) DEPC water pretreatment rubber running tank, glass plate and other instrument accessories required for the test. The instrument uses a BI...

Embodiment 3

[0054] After 72 hours of sheath blight infecting rice, wild-type plants with lsiR59604 overexpression siR109944OE had more obvious disease symptoms than rice, indicating that lsiR59604 overexpression plants inhibited the infection of sheath blight ( image 3 ). At the same time, trypan blue staining of the leaf tissue found that the wild type had obvious necrotic spots, and the biomass of sheath blight in the wild type rice was also significantly higher than that of the rice lsiR59604 overexpressed plants ( Figure 4 ), indicating that rice lsiR59604 overexpression plants can significantly enhance the resistance to sheath blight.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of rice long-chain small RNA. The invention provides an lsiR59604 sequence and application of constructing an overexpression vector in rice sheath blight resistance. Experiments prove that a rice lsiR59604 overexpression plant can inhibit infection of sheath blight and enhance the resistance of rice to sheath blight, which indicates that lsiR59604 plays an important role in regulating and controlling the resistance of rice to sheath blight.

Description

Technical field: [0001] The invention belongs to the field of biotechnology, and relates to the application of rice long-chain small RNA. Background technique: [0002] Rice sheath blight, caused by Rhizoctonia solani (R. solani), is one of the most destructive fungal diseases of rice. At present, commercial fungicides are the most effective measures to control sheath blight, but excessive use may cause environmental hazards. At present, rice sheath blight resistance breeding is not perfect, the main reason is the lack of effective resistance genes for rice variety breeding. Small RNAs are non-coding RNAs that cause gene silencing in most eukaryotes. According to the synthesis pathway of small RNAs, small RNAs in plants are mainly divided into microRNAs (miRNAs) and small interfering RNAs (siRNAs). Studies have shown that miRNAs are related to the immune response of rice to pathogens such as blast fungus (M. oryzae), Xanthomonas (Xoo) and so on. For example, in transgeni...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/46C12Q1/6895
CPCC12N15/113C12N15/8282C12Q1/6895C12Q2600/13C12Q2600/158C12Q2600/178
Inventor牛冬冬郑礼煜郑颖李文奇刘昌来
OwnerNANJING AGRICULTURAL UNIVERSITY