A kind of host Aspergillus oryzae knockout system and its construction method and application

A construction method, the technology of Aspergillus oryzae, applied in the field of molecular biology, can solve the problems of high false positive and complicated transformation operation

Active Publication Date: 2021-08-20
QILU UNIV OF TECH +1
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the deficiencies in the prior art, the present invention provides a host Aspergillus oryzae knockout system and its construction method and application, which is mediated by a double selection plasmid of hygromycin resistance and RFP fluorescent protein, and prepared by protoplasts To solve the problems of complex transformation operations and high false positives existing in the existing system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of host Aspergillus oryzae knockout system and its construction method and application
  • A kind of host Aspergillus oryzae knockout system and its construction method and application
  • A kind of host Aspergillus oryzae knockout system and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0067] The construction method of the Aspergillus oryzae gene knockout system mediated by hygromycin resistance and RFP fluorescent protein particles is as follows:

[0068] 1) Construction of HPH+RFP expression element

[0069] ① Cloning the hygromycin resistance gene, the sequence is shown in SEQ ID NO: 5, and the nucleotide sequences of the primers used are as follows:

[0070] HPH-F: ATAAGCTTGATATCGAATTC GGAGGTCAACACATCAATGC; SEQ ID NO. 1

[0071] HPH-R: ACGTCCTCGGAGGAGGCCAT CTCTATTCCTTTGCCCTCGG; SEQ ID NO. 2

[0072] The size of the obtained fragment is 1.4kb, and the 20bp sequence of the backbone fragment and the 20bp sequence of the RFP start (underlined) are added to the two ends of the fragment; the RFP sequence is amplified, and the two ends of the same primer are respectively added to the end of the HPH sequence The 20bp bases on the 20bp sequence and the backbone (underlined), the nucleotide sequences of the primers used are as follows:

[0073] RFP-F: CCG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a host Aspergillus oryzae expression system and its construction method and application. The construction method of the host Aspergillus oryzae expression system, the steps are as follows: (i) on the multi-cloning site of the recombinant plasmid pBluescript-hph-rfp is constructed to knock out the homology arm by the method of enzymatic cleavage connection; (ii) activate the The resulting Aspergillus hyphae are added to the cell wall lysing enzyme solution to obtain competent protoplasts; then a recombinant plasmid containing knockout homology arms is added to obtain transformed protoplasts; (iii) the transformed protoplasts are screened and cultured to select Transformants, the host Aspergillus oryzae expression system was prepared. The present invention applies RFP red fluorescent protein to the process of Aspergillus oryzae gene knockout for the first time, which can quickly and effectively eliminate a large number of false positive transformants.

Description

technical field [0001] The present invention relates to a host Aspergillus oryzae expression system and its construction method and application, in particular to using a variety of wall-breaking enzymes to degrade the cell wall of fungi, using a double selection plasmid with hygromycin resistance and RFP red fluorescent protein as a mediator, The gene knockout system of Aspergillus oryzae constructed by the method of protoplast transformation belongs to the technical field of molecular biology. Background technique [0002] Aspergillus oryzae is widely used in industry and food industry because of its strong extracellular protein secretion ability. Aspergillus oryzae grows fast, and initially presents yellow or yellow-green colonies, which turn yellowish-brown as the strain grows later, and can produce a large number of conidia. Aspergillus oryzae has a rich enzyme system, which can produce protease, amylase and pectinase and so on. Due to its efficient protein secretion a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/80C12N1/15C12R1/69
CPCC07K14/43595C12N15/80
Inventor 王婧臻郑红云楚杰王莹
Owner QILU UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap