Primer group, probe and kit for detection of Schistosoma mansoni
A technology of Schistosoma mansoni and a kit, which is applied in the field of primers, probes and kits for detecting Schistosoma mansoni, which can solve the problems of high cost, high false positive, cumbersome and difficult pathogen isolation and cultivation, etc., and achieve simple operation and specificity Strong, sensitive and accurate results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] The composition of the kit is shown in Table 1. In this example, the primers and probes in this example were entrusted to Sangon Bioengineering (Shanghai) Co., Ltd. to synthesize and pass the HPLC test. The fluorescent reporter group of the probe is FAM. The killing group is BHQ1. The modified probe is GTATCTCCGAAACCACTGGACGGATTTTTA / i6FAMdT / G / idSp / / iBHQ1dT / GTTTGTTTTAGATTA.
[0063] The kit composition of table 1 embodiment 1
[0064]
[0065] Sensitivity Evaluation Test
[0066] Transfer 5 μL of Schistosoma mansoni gene recombinant DNA plasmid to Escherichia coli and extract it at a concentration of 10 10 Copies / μL DNA plasmids are used to make working standards of different gradients, which are:
[0067] Working Standard 1, containing 1.0 × 10 6 copies / μL Non-infectious DNA fragment of the 121bp tandem repeat gene of Schistosoma mansoni.
[0068] Working Standard 2, containing 1.0 × 10 5 copies / μL Non-infectious DNA fragment of the 121bp tandem repeat gene of ...
Embodiment 2 to 8
[0095] Adopt the kit identical with embodiment 1, identical method to carry out sensitivity evaluation test, Schistosoma mansoni sample detection test and specificity evaluation test respectively, difference with embodiment 1 is that the reaction temperature and reaction time of instrument setting are different, The specific differences are shown in Table 2.
[0096] The reaction conditions of table 2 embodiment 2 to 8
[0097]
[0098]
[0099] The test results of Examples 2 to 8 are similar to those of Example 1, with high sensitivity and specificity and good repeatability.
Embodiment 9
[0101] The composition of the kit is shown in Table 3, wherein the fluorescent reporter group of the probe in this embodiment is FAM, and the quencher group is TAMRA.
[0102] The kit composition of table 3 embodiment 9
[0103]
[0104] The sensitivity evaluation test, Schistosoma mansoni sample detection test and specificity evaluation test were carried out using the same method and test conditions as in Example 1. The test results were similar to those in Example 1, with high sensitivity and specificity and good repeatability.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com