Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer group, probe and kit for detection of Schistosoma mansoni

A technology of Schistosoma mansoni and a kit, which is applied in the field of primers, probes and kits for detecting Schistosoma mansoni, which can solve the problems of high cost, high false positive, cumbersome and difficult pathogen isolation and cultivation, etc., and achieve simple operation and specificity Strong, sensitive and accurate results

Pending Publication Date: 2020-02-14
JIANGSU INST OF PARASITIC DISEASES +1
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Based on this, it is necessary to provide a primer set, probe and kit for detecting Schistosoma mansoni in view of the traditional detection methods of Schistosoma mansoni or the technical problems of cumbersome and difficult isolation and culture of pathogens, or high false positives, or high cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group, probe and kit for detection of Schistosoma mansoni
  • Primer group, probe and kit for detection of Schistosoma mansoni
  • Primer group, probe and kit for detection of Schistosoma mansoni

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] The composition of the kit is shown in Table 1. In this example, the primers and probes in this example were entrusted to Sangon Bioengineering (Shanghai) Co., Ltd. to synthesize and pass the HPLC test. The fluorescent reporter group of the probe is FAM. The killing group is BHQ1. The modified probe is GTATCTCCGAAACCACTGGACGGATTTTTA / i6FAMdT / G / idSp / / iBHQ1dT / GTTTGTTTTAGATTA.

[0063] The kit composition of table 1 embodiment 1

[0064]

[0065] Sensitivity Evaluation Test

[0066] Transfer 5 μL of Schistosoma mansoni gene recombinant DNA plasmid to Escherichia coli and extract it at a concentration of 10 10 Copies / μL DNA plasmids are used to make working standards of different gradients, which are:

[0067] Working Standard 1, containing 1.0 × 10 6 copies / μL Non-infectious DNA fragment of the 121bp tandem repeat gene of Schistosoma mansoni.

[0068] Working Standard 2, containing 1.0 × 10 5 copies / μL Non-infectious DNA fragment of the 121bp tandem repeat gene of ...

Embodiment 2 to 8

[0095] Adopt the kit identical with embodiment 1, identical method to carry out sensitivity evaluation test, Schistosoma mansoni sample detection test and specificity evaluation test respectively, difference with embodiment 1 is that the reaction temperature and reaction time of instrument setting are different, The specific differences are shown in Table 2.

[0096] The reaction conditions of table 2 embodiment 2 to 8

[0097]

[0098]

[0099] The test results of Examples 2 to 8 are similar to those of Example 1, with high sensitivity and specificity and good repeatability.

Embodiment 9

[0101] The composition of the kit is shown in Table 3, wherein the fluorescent reporter group of the probe in this embodiment is FAM, and the quencher group is TAMRA.

[0102] The kit composition of table 3 embodiment 9

[0103]

[0104] The sensitivity evaluation test, Schistosoma mansoni sample detection test and specificity evaluation test were carried out using the same method and test conditions as in Example 1. The test results were similar to those in Example 1, with high sensitivity and specificity and good repeatability.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer group, probe and kit for detection of Schistosoma mansoni. The primer group includes an upstream primer and a downstream primer, wherein the sequence of the upstream primer is shown in SEQ ID No. 1, the sequence of the downstream primer is shown in SEQ ID No. 2. The primer group for detection of Schistosoma mansoni and a probe and kit for detection of Schistosoma mansoniare has simple and convenient operation. It is verified through tests that when the primer group, probe and kit for detection of Schistosoma mansoni are applied to detection of Schistosoma mansoni, high specificity, high sensitivity, high accuracy and good repeatability are achieved, test results can be obtained within 20 minutes, and the primer group, probe and kit have low requirements fortest conditions and technologies of the test staff and low test cost.

Description

technical field [0001] The invention relates to the technical field of molecular biology detection, in particular to a primer set, a probe and a kit for detecting schistosoma mansoni. Background technique [0002] Schistosomiasis is a global parasitic disease that seriously endangers human health. There are five main types of human schistosomiasis, namely Japanese, Egyptian, mansoni, intercalated and Mekong schistosomiasis, among which the infections caused by Egyptian (Schistosoma haematobium), Mansoni (S.mansoni) and Japanese schistosomiasis (S.japonicum) Schistosomiasis is the most prevalent. Among them, schistosomiasis mansoni is the most widely distributed and has the largest number of patients. It is distributed in 54 countries in the Arabian Peninsula, Africa and Latin America, and the number of people at risk is about 400-500 million. [0003] As the number of people going abroad for labor, construction, business and tourism in my country has increased year by year...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6844C12N15/11
CPCC12Q1/6888C12Q1/6844C12Q2521/507C12Q2522/101
Inventor 杨坤李伟赵松何健刘燕红应清界
Owner JIANGSU INST OF PARASITIC DISEASES
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More