Preparation and purification method of recombinant adenovirus expressing sox4 gene

A technology of gene recombination and adenovirus, applied in the field of genetic engineering, can solve the problems of low transfection efficiency of overexpression vector, short time effect of overexpression and high cost

Active Publication Date: 2020-12-01
HENAN POLYTECHNIC UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the establishment of Sox4 gene overexpression mouse models takes a long time and the cost is high, if the cells cultured in vitro are used as the research object, the transfection efficiency of the overexpression vector is generally low, and the overexpression time is short. Therefore, to study the Sox4 gene recombinant adenovirus, It can achieve sustained overexpression of Sox4 gene in mouse tissues and in vitro cells, laying a good technical foundation for studying the function of Sox4 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and purification method of recombinant adenovirus expressing sox4 gene
  • Preparation and purification method of recombinant adenovirus expressing sox4 gene
  • Preparation and purification method of recombinant adenovirus expressing sox4 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The invention provides a method for preparing and purifying recombinant adenovirus expressing Sox4 gene. Based on the pAdtrack-CMV adenovirus expression vector, the Sox4 gene was introduced to obtain a recombinant adenovirus expressing the Sox4 gene. A large amount of adenovirus was cultured in HEK293 cells, and the virus was purified by cesium chloride gradient centrifugation.

[0033] A preparation method of recombinant adenovirus expressing Sox4 gene

[0034] Step A1, using the mouse Sox4 (NCBI Reference Sequence: NM_009238.2) gene sequence as a template, according to the pAdtrack-CMV vector sequence, select KpnI and HindIII restriction sites to design the sequence, and clone the full-length CDS sequence of Sox4, The primer sequences are as follows:

[0035] Sense: GGGGTACCATGGTACAACAAGACCAACAACG

[0036] Antisense: CCCAAGCTTTCAGTAGGTGAAGACCAGGTTAGA

[0037] Step A2, amplify the Sox4 gene sequence, extract mouse liver tissue RNA, and reverse transcribe it into cD...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for preparing and purifying recombinant adenovirus expressing Sox4 gene, and belongs to the field of genetic engineering. The method connects an Sox4 gene fragment withan adenovirus pAdtrack-CMV carrier to obtain a recombinant adenovirus expression plasmid pAdtrack-Sox4. Recon formed by linearized pAdtrack-Sox4 and an AdEasy carrier transfects HEK293 cells to generate adenovirus. The virus is purified by gradient centrifugation of cesium chloride, the virus titer is detected by a micro total cell pathological change method, and finally, the whole process of adenovirus packaging, production and purification is realized. The recombinant adenovirus of Sox4 gene can successfully infect 293T cells and mouse inguinal adipose tissues to realize continuous high expression of Sox4 gene in somatic cells and mouse tissues, which lays a good technical foundation for future research on the function of the Sox4 gene.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a method for preparing and purifying a recombinant adenovirus expressing Sox4 gene. Background technique [0002] Sox4 is a member of the Sox family. The Sox4 gene does not contain introns, only contains a longer exon, and the length of the transcribed mouse-derived mRNA fragment is 2969bp. The high expression of Sox4 gene mainly exists in the central nervous system, lung, thymus, epidermal stem cells and glioma stem cells of developing embryos. Sox4 is closely related to the occurrence of human diseases. Mutations or deletions of the Sox4 gene can lead to congenital diseases, developmental abnormalities and tumor formation. Studies have also shown that Sox4 plays an important decisive role in cell differentiation and proliferation. Sox4 - / - Mouse embryonic lethality, while Sox4 - / + Bone formation was significantly reduced in mice and cartilage development was...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/861C12N15/66C12N7/02
CPCC07K14/4702C12N7/00C12N15/86C12N2710/10043C12N2710/10051
Inventor 李胜楠张殿龙宋文婷王振辉李园利邢秀玲
Owner HENAN POLYTECHNIC UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap