Preparation and purification method of recombinant adenovirus expressing sox4 gene
A technology of gene recombination and adenovirus, applied in the field of genetic engineering, can solve the problems of low transfection efficiency of overexpression vector, short time effect of overexpression and high cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0032] The invention provides a method for preparing and purifying recombinant adenovirus expressing Sox4 gene. Based on the pAdtrack-CMV adenovirus expression vector, the Sox4 gene was introduced to obtain a recombinant adenovirus expressing the Sox4 gene. A large amount of adenovirus was cultured in HEK293 cells, and the virus was purified by cesium chloride gradient centrifugation.
[0033] A preparation method of recombinant adenovirus expressing Sox4 gene
[0034] Step A1, using the mouse Sox4 (NCBI Reference Sequence: NM_009238.2) gene sequence as a template, according to the pAdtrack-CMV vector sequence, select KpnI and HindIII restriction sites to design the sequence, and clone the full-length CDS sequence of Sox4, The primer sequences are as follows:
[0035] Sense: GGGGTACCATGGTACAACAAGACCAACAACG
[0036] Antisense: CCCAAGCTTTCAGTAGGTGAAGACCAGGTTAGA
[0037] Step A2, amplify the Sox4 gene sequence, extract mouse liver tissue RNA, and reverse transcribe it into cD...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



