Limited self-replication mRNA molecular system, preparation method and application

A molecular and limited technology, applied in the field of preparation and limited self-replication mRNA molecular system, can solve the problem that mRNA cannot achieve limited self-replication, and achieve the effect of avoiding cytotoxicity and achieving continuous expression.

Active Publication Date: 2021-12-28
ZHENHE PHARM (HANGZHOU) CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a limited self-replication mRNA molecular system, preparation method and application, to solve the technical problem that mRNA cannot realize limited self-replication in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Limited self-replication mRNA molecular system, preparation method and application
  • Limited self-replication mRNA molecular system, preparation method and application
  • Limited self-replication mRNA molecular system, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0097] Example 1: Synthesis of the first mRNA

[0098] Step 1. Use GeneArtTM Gibson HiFi reaction (U.S. ThermoFisher, A46624) synthesized the DNA coding sequence of mutant replicase (the nucleic acid molecule encoding the first mRNA did not contain polyadenylic acid sequence), and after the synthesis was successful, the DNA encoding sequence of the mutant replicase was cloned into pcDNA3. 3 vector plasmids for industrial production.

[0099] 1.1 Mutant replicase DNA coding sequence: 5' untranslated region DNA sequence (SEQ ID NO.9), mutant replicase coding sequence (SEQ ID NO.2), 3' untranslated region DNA sequence (SEQ ID NO. 10), wherein, mutant replicase coding sequence (SEQ ID NO.2) is divided into nsP1 region fragment (SEQ ID NO.3), nsP2 region fragment (SEQ ID NO.4), nsP3 region fragment (SEQ ID NO.4) 5) Four DNA fragments of the nsP4 region fragment (SEQ ID NO. 6), all of which are modified fragments with high GC content. The four DNA fragments were ordered directly...

Embodiment 2

[0137] Example 2: Synthesis of Second mRNA

[0138] The synthesis steps of the second mRNA are similar to those of the first mRNA, including the following steps:

[0139] Step 1. Use GeneArtTM Gibson HiFi reaction (U.S. ThermoFisher, A46624) synthesizes the specifically modified DNA coding sequence of the target protein (the nucleic acid molecule encoding the second mRNA does not contain polyadenylic acid sequence);

[0140] Wherein, the specific modified target protein DNA coding sequence: 5' untranslated region DNA sequence (SEQ ID NO.9), replicase 5' end specific DNA sequence (SEQ ID NO.7), target protein DNA coding sequence ( Please refer to Table 6), replicase 3' end specific DNA sequence (SEQ ID NO. 8), 3' untranslated region DNA sequence (SEQ ID NO. 10).

[0141] Step 2, adding the poly-(a) tail of mRNA to the specifically modified target protein DNA coding sequence by PCR to obtain the DNA synthesis template of the second mRNA;

[0142] Step three, in vitro transcr...

Embodiment 3

[0149] This embodiment provides a pharmaceutical composition, multiple molecular messenger RNA and a delivery carrier, wherein the multiple molecular messenger RNA includes the first mRNA prepared in Example 1 and the second mRNA-1 prepared in Example 2, and the delivery carrier is protamine protein. In this example, the target protein is Taffazin protein.

[0150] Example 3 Application-Therapeutic Experiment of Mouse Barth Syndrome Model

[0151] 3.1 Mouse Barth syndrome model and induction:

[0152] Doxycycline was introduced into the mouse genome to induce Knock down of Taffazin protein to establish a mouse model of Barth syndrome. The DNA was determined by PCR analysis for genotyping. Primers:

[0153] 5' CCATGGAATTCGAACGCTGACGTC 3' (SEQ ID NO. 45);

[0154] 3' TATGGGCTATGAACTAATGACCC 5' (SEQ ID NO. 46);

[0155] In this case, only males were used, and doxycycline was placed in the drinking water of mice at a concentration of 2 mg / L, which also contained 10% sucrose....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biological medicine, in particular to a limited self-replication mRNA molecular system, a preparation method and application. The limited self-replication mRNA molecular system comprises first mRNA for coding alphavirus mutant replicase and at least one second mRNA for coding target protein, and by generating specific mutation adjustment in an nsP2 subunit of the mutant replicase, the limited self-replication mRNA molecular system can realize limited self-replication and avoid generation of cytotoxicity; and different mRNAs are constructed by the mutant replicase and different target proteins, and the mutant replicase coded by the first mRNA can simultaneously and limitedly replicate a plurality of different target proteins, so that continuous expression of multiple target proteins is realized.

Description

【Technical field】 [0001] The invention relates to the technical field of biomedicine, in particular to a limited self-replicating mRNA molecular system, a preparation method and an application. 【Background technique】 [0002] Messenger RNA (mRNA) therapy is a novel treatment modality with potential for a wide range of clinical applications, including vaccines against infectious agents as well as treatments for cancer or genetic diseases, regenerative therapies and immunotherapy. Compared with protein-based biologics, the advantages of messenger RNA therapy include that messenger RNA can synthesize proteins through the body's own cells without the need for complex protein synthesis and purification processes or production lines; intracellular and membrane-bound proteins can be targeted as therapeutic targets ; It can be quickly industrialized under cell-free GMP conditions, and the cycle from research and development to products is short. [0003] However, the application of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/54C12N15/10C12N5/10C12N15/87C12N15/26C12N15/12C12N15/37C12N15/38C12N15/44C12N15/49C12N15/34C12N15/55A61K39/00A61K39/39A61K48/00A61P35/00A61P37/02
CPCC12N9/127C12N15/10C12N5/0696C12N15/87C07K14/55C07K14/4715C07K14/005C12N9/22C07K14/43595C07K14/435A61K39/39A61K48/005A61K39/0011A61P37/02A61P35/00C12Y207/07048C12N2501/606C12N2501/604C12N2501/602C12N2501/603C12N2501/608C12N2710/20022C12N2710/16622C12N2760/16022C12N2740/16022C12N2710/12022A61K2039/55516A61K2039/53C12Q2531/113C12Q2521/327A61P9/00C12N15/86C12N2760/16122C12N2770/20022
Inventor王刚于寅黄健易桦林
OwnerZHENHE PHARM (HANGZHOU) CO LTD