Recombinant vector, preparation method thereof and method for improving turnip mosaic virus resistance and/or yield of vegetable crops
A technology of recombinant vectors and vegetables, applied in the biological field, can solve the problems of incomplete reference sequences and the inability to study the role of miR1885a in depth, and achieve the effect of strong resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1 Construction of STTM-1885-1885 vector
[0040] (1) Use the pOT2-poly-cis vector as a template, and use the following primers to carry out PCR amplification under the catalysis of LongAmp Taq enzyme (purchased from NEB Company);
[0041] Upstream primer (5'→3'): gccATTTAAATatggtctaaagaagaagaat GGAATCATACC cta TTTCAT TGATG gaattcggtacgctgaaatcaccag (underlined is the reverse complementary sequence of bra-miR1885a) (SEQ ID NO.1)
[0042] Downstream primer (5'→3'): gccATTTAAATtagaccataacaacaacaac CATCAATGAAA tag GGTATG ATTCC aagcttgggctgtcctctccaaatg (the sequence of bra-miR1885a is underlined) (SEQ ID NO. 2).
[0043] PCR amplification program:
[0044] 94°C, 2 minutes;
[0045] [94°C, 30 seconds; 58°C, 30 seconds; 68°C, 4 minutes] 30 cycles;
[0046] 68°C, 10 minutes;
[0047] 4°C, 1 minute.
[0048] After the PCR product was recovered, it was digested with SwaI. After purifying and recovering the digested fragments with a DNA purification c...
Embodiment 2
[0057] The acquisition of embodiment 2 Brassica napus / STTM-1885-1885
[0058] Using Westar ecotype Brassica napus (B.napus cv.Westar) as the recipient plant, transfer the recombinant vector STTM-1885-1885 into Westar ecotype Brassica napus, and obtain Brassica napus expressing STTM-1885-1885 fragment / STTM-1885-1885.
[0059] The specific method is as follows:
[0060] (1) Transformation of Brassica napus
[0061] 1.1 Culture medium preparation
[0062] Murashige&Skoog (MS) medium powder (purchased from Duchefu company)
[0063] Medium 0 medium: 1 / 2MS (MS 2.2g), 30g sucrose, add double distilled water to about 950ml to adjust the pH to 5.8-6.0, add double distilled water to adjust the volume to 1000ml, add plant agar Phytagel (purchased from Sigma company) 3.5g, sterilized by high temperature steam at 113℃ for 20min.
[0064] Dilute medium: MS 4.4g, sucrose 30g, add double distilled water to 1000ml to adjust pH to 5.8, sterilize by high temperature steam at 113°C for 20mi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


