A sort of kda2 Application of Genes in Improving Plant Resistance to Botrytis Botrytis Infection

A technology of Botrytis cinerea and plants, applied in the fields of application, plant products, genetic engineering, etc., can solve the problem that there is no report on the role of real subcellular localization

Active Publication Date: 2021-03-23
QINGDAO AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there is no report on the true subcellular localization of this gene and its role in plant disease resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A sort of  <i>kda2</i> Application of Genes in Improving Plant Resistance to Botrytis Botrytis Infection
  • A sort of  <i>kda2</i> Application of Genes in Improving Plant Resistance to Botrytis Botrytis Infection
  • A sort of  <i>kda2</i> Application of Genes in Improving Plant Resistance to Botrytis Botrytis Infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: tomato KDA2 Gene amplification and subcellular localization

[0032] 1. Tomato KDA2 gene amplification

[0033] Get Tomatoes in the GeneBank Database KDA2 The CDS sequence of the gene is 1347 bp in length and encodes a protein containing 449 amino acids. The nucleotide sequence is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2.

[0034] based on found tomatoes KDA2 Specific primers were designed for the CDS sequence of the gene, and the primer sequences were as follows:

[0035] PQB-KDA2-F 5'- ATGGATTCTTCAGTCGTGGAGG-3' (SEQ ID NO. 3);

[0036] PQB-KDA2-R 5'-AAGATTGTAGTAATTACTGAACTTTC-3' (SEQ ID NO. 4).

[0037] Use TRI Reagent to extract the total RNA of tomato, and use the reverse transcription kit to perform reverse transcription to obtain the cDNA chain, then use it as a template, use the above-mentioned specific primers to perform PCR amplification on the obtained cDNA using high-fidelity enzymes, and the electrophor...

Embodiment 2

[0042] Example 2: tomato KDA2 Generation of knockout mutants and homozygous lines

[0043] 1. Tomato KDA2 Obtaining knockout mutants

[0044] (1) Vector construction

[0045] KDA2 The full-length gene coding sequence (CDS) is shown in SEQ ID NO.7, input on the CRISPRdirect website KDA2 The full sequence of the gene, screen the appropriate target according to the results, and design primers accordingly, the primer sequence is as follows (the underlined part is KDA2 target):

[0046] KDA2-F0: 5'-ATATATGGTCTCGTTTG GCCGTAATCATATTCGCCGA

[0047] GTTTTAGAGCTAG AAATAGC-3' (SEQ ID NO. 8);

[0048] KDA2-R05'-ATTATTGGTCTCGAAAC TAGTCGCCGGAAACGGTTCA

[0049] CAAACTACACTGTT AGATTC-3' (SEQ ID NO. 9).

[0050] Using the plasmid pTX-043 as a template and using the above primers, the target sequence KDA20 (knockout target) was amplified by PCR with high-fidelity enzymes, and the amplified product was recovered and purified. The PCR product and the pTX-041 plasmid were digested wi...

Embodiment 3

[0062] Example 3: Positive KDA2 Phenotype Identification of Knockout Plants

[0063] 1. Select KDA2 knockout line KDA2-4-20 , KDA2-5-7 and KDA2-6-3 Seeds of wild-type tomato (WT) were sown in nutrient soil and cultured in the greenhouse. The culture conditions were 16h light (26°C) / 8h dark (18°C). Then, choose about 4 weeks, the same size and growth KDA2 There were 3 groups of knockout mutant plants and wild type, each group contained 3 tomato plants, and the concentration of spores was 10 6 The spore liquid inoculated tomato leaves, put the leaves in a plastic box, covered with a layer of plastic wrap to maintain 100% humidity, kept at 22°C for 24-48 hours, observed the incidence of tomato leaves and made statistics. The results are shown in Figure 4, compared with the wild type, KDA2 The diameter of the lesion on the leaves of the gene knockout line was significantly reduced, indicating that KDA2 Genes important for tomato resistance to Botrytis cinerea infection...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of a KDA2 gene in improving plant resistance to botrytis cinerea infection. The invention separates and clones a KDA2 gene from tomato, constructs a subcellular positioning recombinant vector pK7FW2-KDA2, a gene knockout recombinant vector pTX-KDA2, a gene knockout recombinant strain LBA4404-pTX-KDA2, and a tomato KDA2 gene knockout homozygous strain. The invention proves that knocking out the KDA2 gene can effectively improve the resistance of tomato to botrytis cinerea, and compared with a wild-type strain, the tomato KDA2 gene knockout strain has significantly reduced disease spot diameter on the leaves. Experiments prove that the KDA2 gene has an application value in improving the gray mold resistance of tomatoes, and a good theoretical and application basis is laid for breeding disease-resistant plants by using the KDA2 gene.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, in particular to a KDA2 Application of genes in improving plant resistance to Botrytis cinerea infection. Background technique [0002] Tomato is an important economic crop in my country. Botrytis cinerea (also known as Botrytis cinerea) caused by Botrytis cinerea (also known as Botrytis cinerea) is one of the important diseases in tomato production and is a threat to tomato production. A devastating saprophytic fungal disease. Botrytis cinerea not only infects tomato fruits, but also infects different parts of tomato stems, leaves, flowers, etc., and spreads quickly, seriously affecting tomato yield and economic benefits. Botrytis cinerea also has the characteristics of easy variation and polymorphism, and is easily affected by the environment and hosts to produce new variations. At present, the control of tomato gray mold is mainly chemical control and agricultural control, but the co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/55C12N15/82A01H5/12A01H6/82
CPCC12N9/80C12N15/8218C12N15/8282
Inventor梁文星宋丽敏李晓霞王雪
OwnerQINGDAO AGRI UNIV