A sort of klp1 Application of Genes in Improving Plant Resistance to Botrytis Botrytis Infection

A botrytis and plant technology, applied in the field of plant genetic engineering, can solve the problems of small molecular weight and unclear biological function of tomato KLP1 protein, etc.

Active Publication Date: 2021-04-13
QINGDAO AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Tomato KLP1 protein is a small molecular protein unique to tomato, with a total of 812 nucleotides and 147 amino acids encoded. The protein has a conserved functional domain Bet-v-1, but there are many differences between KLP1 protein and PR-10 family. There are big differences, such as the molecular weight of KLP1 protein is smaller than that of PR-10 family, and it does not contain the conserved P-loop of PR-10 family protein, etc., but the biological function of tomato KLP1 protein is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A sort of  <i>klp1</i> Application of Genes in Improving Plant Resistance to Botrytis Botrytis Infection
  • A sort of  <i>klp1</i> Application of Genes in Improving Plant Resistance to Botrytis Botrytis Infection
  • A sort of  <i>klp1</i> Application of Genes in Improving Plant Resistance to Botrytis Botrytis Infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: tomato KLP1 Gene amplification and expression pattern analysis

[0038] 1. Obtain tomato in GeneBank database KLP1 The CDS sequence of the gene is 441 bp in length, encoding a protein containing 147 amino acids, its nucleotide sequence is shown in SEQ ID NO.1, and its encoded amino acid sequence is shown in SEQ ID NO.2,

[0039] according to tomato KLP1 Specific primers were designed for the CDS sequence of the gene, and the primer sequences were as follows:

[0040] PQB-KLP1-F: 5'-ATGGGTTTAAAAGGTAAGTTGATTG-3' (SEQ ID NO.3);

[0041] PQB-KLP1-R: 5'-AATCTTGTGGAGGTGACCCTCTA-3' (SEQ ID NO. 4).

[0042] Use TRI Reagent to extract the total RNA of tomato, and use the reverse transcription kit to perform reverse transcription to obtain the cDNA chain, then use it as a template, use the above-mentioned specific primers to perform high-fidelity enzyme amplification on the obtained cDNA, and then the obtained The amplified product was recovered and purified and t...

Embodiment 2

[0050] Example 2: tomato KLP1 Generation of knockout mutants and homozygous lines

[0051] 1. Tomato KLP1 Obtaining knockout mutants

[0052] (1) Vector construction

[0053] KLP1 The full-length gene coding sequence (CDS) is shown in SEQ ID NO.9, input on the CRISPRdirect website KLP1 Based on the full sequence of the gene, suitable targets were screened according to the results. The selected targets were: GAAGGTGAAGATCTAAGAGC and GAACCCGTCACTCTTCTGAA, and primers were designed accordingly. The primer sequences are as follows:

[0054] KLP1-F0:

[0055] 5’-ATATATGGTCTCGTTTGAAGGTGAAGATCTAAGAGCGTTTTAGAGC

[0056] TAGAAATAGC-3' (SEQ ID NO. 10);

[0057] KLP1-R0:

[0058] 5’-ATTATTGGTCTCGAAACGAACCCGTCACTCTTCTGAACAAACTACA

[0059] CTGTTAGATTC-3' (SEQ ID NO. 11).

[0060] The plasmid pTX-043 was used as a template, KLP1-F0 and KLP1-R0 were used as primers, and the target sequence KLP0 (knockout target) was amplified by PCR with high-fidelity enzymes. The electrophoresis r...

Embodiment 3

[0073] Example 3: Positive tomato KLP1 Phenotype Identification of Knockout Plants

[0074] 1. will KLP1 knockout line KLP1-1-3 with KLP1-30-5 The seeds of wild-type tomato (WT) and wild-type tomato (WT) were sown in nutrient soil and cultured in a greenhouse under the conditions of 16h light (26°C) / 8h dark (18°C). Then, choose about 4 weeks, the same size and growth KLP1 Gene knockout homozygous lines and wild type were divided into 3 groups, each group contained 3 tomato plants, and the concentration of spores was 10 6 The spore liquid inoculated the tomato leaves, put the leaves in a plastic box, covered with a layer of plastic wrap to maintain 100% humidity, kept at 22°C for 24-48 hours, then observed the incidence of tomato leaves and made statistics. The result is as Figure 4A with 4B As shown, compared with the wild type, KLP1 The diameter of the lesion on the leaves of the gene knockout homozygous lines was significantly reduced.

[0075] 2. Total RNA was e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a KLP1 Application of genes in improving plant resistance to Botrytis cinerea infection. The present invention is isolated and cloned from tomato KLP1 gene that builds the tomato KLP1 Gene knockout recombinant vector pTX‑ KLP1 , gene knockout recombinant strain LBA4404‑pTX‑ KLP1 and its tomatoes KLP1 Gene knockout homozygous line, the present invention confirms the knockout KLP1 Genes can effectively improve tomato resistance to Botrytis cinerea infection, and tomato KLP1 Compared with the wild-type line, the diameter of the lesions on the leaves and the amount of Botrytis cinerea in the leaves were significantly reduced in the knockout lines. The present invention is confirmed by experiments KLP1 Gene has application value in improving tomato resistance to gray mold, and is useful for utilizing KLP1 Genetic breeding of disease-resistant plants lays a solid theoretical and application basis.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to the application of a KLP1 gene in improving plant resistance to Botrytis cinerea infection. Background technique [0002] Tomato is an important economic crop in my country. Botrytis cinerea (also known as gray mold) caused by Botrytis cinerea (also known as Botrytis cinerea) is one of the important diseases in tomato production and a threat to tomato production. A devastating saprophytic fungal disease. Botrytis cinerea not only infects tomato fruit, but also infects different parts of tomato stems, leaves, flowers, etc., and spreads quickly, seriously affecting tomato yield and economic benefits. Botrytis cinerea also has the characteristics of easy variation and polymorphism, and is easily affected by the environment and hosts to produce new variations. At present, the control of tomato gray mold is mainly chemical control and agricultural control, but the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/12A01H6/82
CPCC07K14/415C12N15/8218C12N15/8282
Inventor宋丽敏梁文星徐阳郭倩倩
OwnerQINGDAO AGRI UNIV