Application of a hda3 gene in improving plant resistance to Botrytis cinerea infection

A botrytis and gene technology, applied in applications, plant products, genetic engineering, etc., can solve problems such as no reports on its effects and few studies, and achieve improved disease resistance, reduced disease spots, and increased Botrytis cinerea infection. the effect of the ability

Active Publication Date: 2021-03-23
QINGDAO AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are not many studies on this gene. It has been reported that this gene is a negative regulator of tomato fruit ripening and carotenoid accumulation, but there is no report on the role of this gene in the process of plant disease resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a hda3 gene in improving plant resistance to Botrytis cinerea infection
  • Application of a hda3 gene in improving plant resistance to Botrytis cinerea infection
  • Application of a hda3 gene in improving plant resistance to Botrytis cinerea infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: tomato HDA3 Gene sequence analysis, cloning and vector construction

[0033] 1, the present invention obtains tomato from GeneBank database HDA3 gene, analysis showed HDA3 The base is 1800bp in full length (sequence shown in SEQ ID NO.1), belongs to the RPD3 / HDA1 family, and its CDS sequence is 1416bp (sequence shown in SEQ ID NO.2, encoding a protein containing 471 amino acids (sequence shown in SEQ ID NO .3),

[0034] according to tomato HDA3 Specific primers were designed for the CDS sequence of the gene, and the primer sequences were as follows:

[0035] HDA3-F: 5'- ATGGACTCCTCCACCGTAGA CG-3' (SEQ ID NO. 4);

[0036] HDA3-R: 5'-GGAGATAATATCAGTTGGTTGATC-3' (SEQ ID NO. 5).

[0037] Use TRI Reagent to extract the total RNA of tomato, and use the reverse transcription kit to perform reverse transcription to obtain the cDNA chain, and then use it as a template to perform high-fidelity enzyme amplification on the obtained cDNA using the above-mentioned s...

Embodiment 2

[0039] Example 2: tomato HDA3 Construction of overexpression plants

[0040] 1. Tomato HDA3 Obtaining overexpression plants

[0041] The pK7FWG2- HDA3 Transformed into LBA4404 Agrobacterium competent, transformed tomato cotyledons by Agrobacterium injection infiltration method. The transformed callus was then screened with the antibiotic Kan, and an empty vector was set as a control; the medium was changed every 2-3 weeks until regenerated shoots were obtained, and the culture conditions were 16h light (26°C) / 8h dark (18°C ).

[0042] Genomic DNA was extracted from regenerated seedlings, and HDA3 Specific primers HDA3-F and HDA3-R were used for PCR amplification to screen plants capable of amplifying specific fragments. The leaves of the PCR-positive plants were taken, the epidermis was torn off, and the subcellular localization of HDA3 was observed under a laser confocal electron microscope. The result is as figure 1 As shown, HDA3 is localized in the nucleus of toma...

Embodiment 3

[0043] Example 3: Positive tomato HDA3 Phenotype Identification of Gene Overexpression Plants

[0044] 1. will HDA3 Gene Overexpression Plants HDA3-GFP-7 , HDA3-GFP-12 and HDA3-GFP-13 The seeds of wild-type tomato (WT) and wild-type tomato (WT) were sown in nutrient soil and cultured in a greenhouse under the conditions of 16h light (26°C) / 8h dark (18°C). Then, choose about 4 weeks, the same size and growth HDA3 There were 3 groups of gene overexpression plants and wild-type plants, each group contained 3 tomato plants, and the tomato leaves were inoculated from the fungus cake on the cultured plate, and the leaves were placed in a plastic box with a layer of plastic wrap on it to keep the tomato leaves intact. 100% humidity, after keeping at 22°C for 24-48 hours, observe the disease of tomato leaves and make statistics. The result is as Figure 4A and 4B As shown, compared with the wild type, HDA3 The diameter of the lesion on the leaves of the gene overexpressed ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of an HDA3 gene in improvement of botrytis cinerea infection resistance of plants. According to the invention, the HDA3 gene is separated and cloned from tomatoes;an overexpression vector pK7FW2-HDA3 of the tomato HDA3 gene, a recombinant strain LBA4404-pK7FW2-HDA3 and a tomato HDA3 overexpression plant are constructed. Experiments prove that the overexpressionHDA3 gene can effectively improve the botrytis cinerea infection resistance of tomatoes. Compared with a wild type strain, the diameter of disease spots on overexpression plant leaves is obviously reduced. QRT-PCR results show that the amount of botrytis cinerea in overexpression plants is obviously reduced compared with that in wild plants. Experiments prove that the HDA3 gene has potential application value in the aspect of improving the botrytis cinerea resistance of tomatoes, and a good theoretical and application foundation is laid for cultivating disease-resistant plants by utilizing the HDA3 gene.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, in particular to a HDA3 Application of genes in improving plant resistance to Botrytis cinerea infection. Background technique [0002] Tomato is an important economic crop in my country. Botrytis cinerea (also known as gray mold) caused by Botrytis cinerea (also known as Botrytis cinerea) is one of the important diseases in tomato production and a threat to tomato production. A devastating saprophytic fungal disease. Botrytis cinerea not only infects tomato fruit, but also infects different parts of tomato stems, leaves, flowers, etc., and spreads quickly, seriously affecting tomato yield and economic benefits. Botrytis cinerea also has the characteristics of easy variation and polymorphism, and is easily affected by the environment and hosts to produce new variations. At present, the control of tomato gray mold is mainly chemical control and agricultural control, but the control effec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/84C12N15/55A01H5/00A01H6/82
CPCC12N9/80C12N15/8205C12N15/8282C12Y305/01098
Inventor梁文星朱明怡王鲁鲁宋丽敏
OwnerQINGDAO AGRI UNIV