Composition for detecting polymorphism and copy number of CYP2D6 gene, kit and method
A gene polymorphism and composition technology, which is applied in biochemical equipment and methods, recombinant DNA technology, and microbial determination/inspection, etc., can solve the problems of high cost, low sensitivity, and inability to detect copy number variation. low cost effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0054] 1. Design primers
[0055] The present invention combines MLPA with sequencing to design primers. First, the present invention is based on CYP2D6*2 (C2850T, rs16947), *3 (A2549del, rs35742686), *4 (G1846A, rs3892097), *10 (C100T, rs1065852) Site design MLPA probe pair, the last base at the 3' end of the F primer is a polymorphic site, the Tm value of the specific binding sequence of F and R is ≧72°C, and then the 5' end of the F primer specific sequence is added The upper 8 N-base molecular tag sequence and the Illumina platform sequencing primer ACACGACGCTCTTCCGATCT, the 3' end of the R primer specific sequence plus the Illumina platform sequencing primer AGATCGGAAGAGCACACGTC. A pair of reference primers were then designed in the conserved region Exon9 in the CYP2D6 gene and the conserved region outside the CYP2D6 gene.
[0056] Table 1. Probe primers
[0057]
[0058]
[0059] Table 2. Amplification primers
[0060]
[0061] 2. Preparation of probe mixture...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com