Primer group for detecting genotypes of oxytocin receptor and application thereof
An oxytocin receptor and primer set technology, which is used in recombinant DNA technology, microbial assay/inspection, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1. Preparation of primer set and kit for detecting oxytocin receptor SNP genotype
[0029] The oxytocin receptor gene OXTR of the embodiment of the present invention is located on 3p25-3p26, includes 4 exons and 3 introns, and has a length of 19,206 base pairs. rs53576[Homo sapiens], Variant type SNV, Alleles: A>G, T, Chromosome: 3:8762685, Homo sapiens chromosome 3, GRCh38.p13 Primary Assembly. The nucleotide sequence of the rs53576 site polymorphism genome is shown in SEQ ID NO:5.
[0030] The primer probe sequences designed for the rs53576 SNP are as follows:
[0031] SEQ ID NO: 1, Rs53576-F: CACACCTCGGGCACAGCA;
[0032] SEQ ID NO: 2, Rs53576-R: CATCTGTAGAATGAGCTTCCCAGC;
[0033] SEQ ID NO: 3, first probe 76FAm: FAM-CCCGAGGATCCTC-MGB
[0034] SEQ ID NO: 4, second probe 76VGm: VIC-CCCGAGGGTCCTC-MGB.
[0035] The fluorescent amplification kit of the embodiment of the present invention includes: fluorescent reaction tube, deionized triple distilled water, M...
Embodiment 2
[0036] Example 2, Amplification of oxytocin receptor SNP rs53576
[0037] 1. Extraction of genomic DNA from blood of pregnant women
[0038] The DNA extraction kit used in this example was purchased from Beijing Zhuangmeng International Biogene Technology Co., Ltd. Add 10 μL of proteinase K and 100 μL of the sample to be tested (EDTA anticoagulated whole blood) into a 1.5ml centrifuge tube, mix well, and centrifuge at 2000 rpm For 10 seconds, add 200 μL of buffer B, mix by inverting, place at 56°C for 10 minutes, mix by inverting for 2-3 times during this period, add 200 μL of absolute ethanol, mix by inverting, and add to the adsorption column, centrifuge at 12000rpm for 30 seconds, discard For waste liquid, put the adsorption column back into the collection tube, add 500 μL buffer C to the adsorption column, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, put the adsorption column back into the collection tube, add 700 μL rinse solution W2 to the adsorption...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


