Supercharge Your Innovation With Domain-Expert AI Agents!

LGI 1 gene mutation and application thereof in preparation of temporal lobe epilepsy co-disease depression animal model

An animal model, gene technology, used in applications, genetic engineering, DNA preparation, etc.

Active Publication Date: 2020-04-14
NANJING MATERNITY & CHILD HEALTH CARE HOSPITAL +3
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

To date no specific genetic animal model has been widely used to study comorbidities of temporal lobe epilepsy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LGI 1 gene mutation and application thereof in preparation of temporal lobe epilepsy co-disease depression animal model
  • LGI 1 gene mutation and application thereof in preparation of temporal lobe epilepsy co-disease depression animal model
  • LGI 1 gene mutation and application thereof in preparation of temporal lobe epilepsy co-disease depression animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0035] 1. Mouse model making

[0036] 1. Design, construction and purification of vectors

[0037] (1) In this strategy, mouse Lgi1-207 (ENSMUST00000198518.4) was selected for production, using the CRISPR Design tool of the Massachusetts Institute of Technology (http: / / crispr.mit.edu / ), and a 20bp target was designed according to the level of Score Target DNA, DNA sequence such as SEQ ID NO.1 (the underlined position is the mutation site a-g. At the same time, in order to prevent the cas9 protein from cutting the knock-in sequence on the Donor vector, construct the Donor vector mutation site and make a synonym on exon1 Mutation site, the double underlined position is mutated to a synonymous mutation made on exon1 (c-a, g-t) The oligonucleotide chain sequence of the sgRNA is used to prepare the sgRNA sequence (the sgRNA sequence is SEQ ID NO.2: CTGAGCCAACAGTGGTAGTA), and a Donor vector carrying the homology arm of the target site and the target knock-in sequence is designed...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene engineering, and in particular relates to new LGI 1 gene mutation causing temporal lobe epilepsy (TLE) newly found in people and an application. The invention discloses the application of the 152nd gene locus A152G mutation of a first exon of an LGI 1 gene in preparation of a temporal lobe epilepsy co-disease depression animal model, and the application in screening of anti-temporal lobe epilepsy co-disease depression drugs. According to the invention, a homozygous model mouse with the gene mutation shows lethal epilepsy; an electroencephalogram of the heterozygous mouse can record epilepsy waveforms, and behavioristics shows that the mouse has co-disease depression; and the mouse can serve as new animal model of epilepsy co-disease depression andis used for mechanism research of epilepsy attack and epilepsy co-disease depression and research and development of anti-epilepsy combined depression drugs.

Description

technical field [0001] The present invention relates to a new LGI1 gene mutation newly discovered in the population that leads to temporal lobe epilepsy (TLE). Homozygous model mice with this gene mutation exhibit lethal epilepsy, and the EEG of heterozygous mice can record epileptic waveforms , Behavioral studies show comorbid depression, which can be used as a new animal model for epilepsy comorbid depression, for research on the mechanism of epilepsy and epilepsy comorbid depression, and for the development of antiepileptic drugs combined with depression. Background technique [0002] Temporal lobe epilepsy (TLE) is the most common focal epilepsy syndrome, often accompanied by pathological abnormalities such as hippocampal sclerosis, neuron loss, glial cell proliferation, and mossy fiber sprouting Abnormal epileptic discharges originate in the temporal lobe of the brain and are partial A type of epilepsy. Temporal lobe epilepsy is divided into lateral temporal lobe epile...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/10C12N15/12A01K67/027A61K49/00
CPCC12N15/8509C12N15/102C07K14/47A01K67/0275A61K49/0008C12N2800/107A01K2217/072A01K2227/105A01K2267/0356
Inventor 胡平许争峰石云臧彦玉吴丹
Owner NANJING MATERNITY & CHILD HEALTH CARE HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More