Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker, primer composition and kit for calculating boettcherisca peregrina larva stage development time, and application

A combination of primers and the technology of Sargassum sargassum, applied in the field of medicine, can solve problems such as time deviations of suspicious personnel committing crimes, and achieve the effect of improving scientificity, rigor, and fair data reference

Active Publication Date: 2020-04-21
CENT SOUTH UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In a case report, a decomposing corpse covered with fly maggots was found in a certain water area, and it was later identified that the fly maggots were mainly larvae of B. After investigation, many witnesses confirmed that the time of the incident was about 128 hours, so this species has certain advantages in PMI estimation, but there are still some shortcomings based on the current traditional method (the actual time of the incident is not within the estimated time range, which will cause Investigators delineate suspicious persons committing crimes time deviation)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker, primer composition and kit for calculating boettcherisca peregrina larva stage development time, and application
  • Molecular marker, primer composition and kit for calculating boettcherisca peregrina larva stage development time, and application
  • Molecular marker, primer composition and kit for calculating boettcherisca peregrina larva stage development time, and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] A molecular marker Spprotein singed46.156 related to the developmental time of the larval stage of the sarcocarpus fly, its DNA sequence is shown in SEQ ID NO.1, specifically:

[0035] atgaacgcga tgctggtagc agattccaaa tcagcattgc cgaggatggc acaggtccgctgggcattga aaaatgaatc acgcggttat ttcctaggcg gcacaccaga caaactagtt tgtactgccaagacacccag ttccggggaa ttttggacag ttcacttggc tgcccgtcca caggttaact tgcgttccataggacgtaaa cgtttcgctc atctatcaga gtctcaagat gagatacatg ttgatgccaa cattccctggggagaagata cactctttac actggaattc cgtcaagagg agggtggtcg ttatgctttg catacctgcaataataaata tttgaatgcc aatggtaaat tgcaaacttt atgcaatgag gattgtctct tcagtgccgaatatcatggt ggccatttgg ctttaagaga taggcaaggc caatatctgt cacctattgg ctctaaggctgtgcttaaat cacgttcttc tactgttaca cgtgatgagt tattctcttt ggaggactca ttgcctcaggcctcatttat agcagccatg aatttacgtt acgtttctgt gaaacaaggt gttgatgtta ctgccaatcaagatgaaatt ggcgaaaatg aaacatttca gttggaattc gattggtccg ctcatcgttg ggctttacgcactacccagg atcgttattg gagtttatca gctggcggtg gcatacaa...

Embodiment 2

[0040] A primer composition used for estimating the larval development time of the sarcalyptus, comprising primers singed-F and singed-R designed according to Spproteinsinged46.156, and primers TY3H-F and TY3H-R designed according to SpTY3H137.42.

[0041] The DNA sequence of said singed-F is shown in SEQ ID NO.3, specifically: ttacgcactacccaggatcg.

[0042] The DNA sequence of said singed-R is shown in SEQ ID NO.4, specifically: taaagagccatcaccatgcc.

[0043] The DNA sequence of the TY3H-F is shown in SEQ ID NO.5, specifically: acggtgaattgttgcatgcc.

[0044] The DNA sequence of the TY3H-R is shown in SEQ ID NO.6, specifically: gaagggtctggacatggtgg.

Embodiment 3

[0046] A kit for estimating the developmental time of the larval stage of the sarcophagus, comprising the primer composition of Example 2, 2×T5 Fast qPCR Mix, 50×ROX Reference Dye II, ddH 2 O.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker, a primer composition and a kit for calculating boettcherisca peregrina larva stage development time, and application, and specifically discloses molecular marker Spprotein singed46.156 target gene. The primer composition comprises singed-F and singed-R. The kit for calculating boettcherisca peregrina larva stage development time comprises a primer composition and a buffer solution. The Spprotein singed46.156 target gene has a potential protein binding function, can be possibly related to synthesis and degradation of a certain protein in the degeneration process of the species, and has remarkable differential expression in different development periods; a molecular genetic marker for larval stage development time calculation is screened out by combining a qRT-PCR technology, and a regression equation of differential expression genes and the development time is constructed to carry out auxiliary judgment of different development stages, the molecular, the primer composition and the kit can be used for calculating the boettcherisca peregrina larva stage development time, and more scientific, objective and fair data reference is provided forPMI inference application in actual cases.

Description

technical field [0001] The invention relates to the field of medical technology, in particular to a molecular marker, a primer composition, a kit and an application for estimating the larval development time of the sarcophagus fly. Background technique [0002] Forensic entomology is a branch of forensic science that applies entomological knowledge to solve legal problems. It has unique advantages in inferring the time of death, especially the postmortem interval (PMI) of decayed corpses. Using the morphological changes in the non-adult stages (eggs, larvae, and pupae) of sarcophilus flies combined with environmental temperature and other conditions to determine the developmental stage and calculate the time elapsed to this stage is the main theoretical basis for the existing PMI inference . There are obvious differences in the growth and development rates of necrophagous flies in different environmental temperatures, so the accurate judgment of the developmental stage is t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q1/6888C12Q2600/166C12Q2531/113C12Q2545/101C12Q2563/107
Inventor 郭亚东任立品柏杨扎拉嘎白乙拉
Owner CENT SOUTH UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products