Molecular marker, primer composition and kit for calculating boettcherisca peregrina larva stage development time, and application
A combination of primers and the technology of Sargassum sargassum, applied in the field of medicine, can solve problems such as time deviations of suspicious personnel committing crimes, and achieve the effect of improving scientificity, rigor, and fair data reference
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] A molecular marker Spprotein singed46.156 related to the developmental time of the larval stage of the sarcocarpus fly, its DNA sequence is shown in SEQ ID NO.1, specifically:
[0035] atgaacgcga tgctggtagc agattccaaa tcagcattgc cgaggatggc acaggtccgctgggcattga aaaatgaatc acgcggttat ttcctaggcg gcacaccaga caaactagtt tgtactgccaagacacccag ttccggggaa ttttggacag ttcacttggc tgcccgtcca caggttaact tgcgttccataggacgtaaa cgtttcgctc atctatcaga gtctcaagat gagatacatg ttgatgccaa cattccctggggagaagata cactctttac actggaattc cgtcaagagg agggtggtcg ttatgctttg catacctgcaataataaata tttgaatgcc aatggtaaat tgcaaacttt atgcaatgag gattgtctct tcagtgccgaatatcatggt ggccatttgg ctttaagaga taggcaaggc caatatctgt cacctattgg ctctaaggctgtgcttaaat cacgttcttc tactgttaca cgtgatgagt tattctcttt ggaggactca ttgcctcaggcctcatttat agcagccatg aatttacgtt acgtttctgt gaaacaaggt gttgatgtta ctgccaatcaagatgaaatt ggcgaaaatg aaacatttca gttggaattc gattggtccg ctcatcgttg ggctttacgcactacccagg atcgttattg gagtttatca gctggcggtg gcatacaa...
Embodiment 2
[0040] A primer composition used for estimating the larval development time of the sarcalyptus, comprising primers singed-F and singed-R designed according to Spproteinsinged46.156, and primers TY3H-F and TY3H-R designed according to SpTY3H137.42.
[0041] The DNA sequence of said singed-F is shown in SEQ ID NO.3, specifically: ttacgcactacccaggatcg.
[0042] The DNA sequence of said singed-R is shown in SEQ ID NO.4, specifically: taaagagccatcaccatgcc.
[0043] The DNA sequence of the TY3H-F is shown in SEQ ID NO.5, specifically: acggtgaattgttgcatgcc.
[0044] The DNA sequence of the TY3H-R is shown in SEQ ID NO.6, specifically: gaagggtctggacatggtgg.
Embodiment 3
[0046] A kit for estimating the developmental time of the larval stage of the sarcophagus, comprising the primer composition of Example 2, 2×T5 Fast qPCR Mix, 50×ROX Reference Dye II, ddH 2 O.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com