Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for realizing rice heterosis fixation

A technology for heterosis and rice, applied in the field of agricultural biology, can solve the problems of inability to fix with heterosis, unable to produce seeds, abnormal development of rice embryos, etc., and achieve the effect of eliminating the risk of breeding seeds and improving the efficiency.

Active Publication Date: 2020-05-08
HUNAN HYBRID RICE RES CENT
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Previous studies have found that adventitious embryonic phenomenon widely exists in rice, which is directly developed through the somatic cells of the nucellus tissue, and the genotype is exactly the same as that of the parent, but because the frequency of occurrence is not high and there is a sexual reproduction mode, it is usually It exists in the form of twin embryos or polyembryonic seedlings, and cannot be used for heterosis fixation in production
In addition, existing studies have also shown that mutations in some genes can lead to abnormal development of rice embryos and the inability to produce seeds.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for realizing rice heterosis fixation
  • Method for realizing rice heterosis fixation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] A method for realizing rice heterosis fixation, comprising the following steps:

[0043] (1) Construction of a vector (expression box A) for specifically expressing the BBM1 gene in rice nucellus: the OsMADS13 promoter was connected to the coding sequence of the rice BBM1 gene, and constructed into the plant binary expression vector pCAMBIA1300. The specific construction method is:

[0044] 1.1. Design primer pairs according to the promoter sequence of OsMADS13 gene.

[0045] The DNA sequence of the promoter seq2 of the OsMADS13 gene is shown in SEQ ID NO.1, and the specific sequence is:

[0046] gatgtctaaatagctataaatgggtaagcaagatagcaaagaaggccagtggcctttgcagctaagctagctagctagcccttcttcctctctttcctgctttccctttgccttctcctattaatcctctgcacctcacacagcagcagaaaacccaccaactggagctctcctttcctactccaagaaacgaaggtagagaaagaaagatcagatcagcttcaggaccaattttagctaggttatatatctctttgcgtgctaatgtgttttagttatctgggtgtgtgtagagttctttgttaaggcactgattcagctgcagtttagattcaagtttgtatgttctctctttgaggaaaagaaacccttttcctgt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for realizing rice heterosis fixation. An OsMADS13 promoter and a rice BBM1 gene coding sequence are connected to construct an expression cassette A; a rice zygotic embryo development key gene OsMPK6 double-target CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Cas9 knockout expression cassette B is constructed; the expression cassette A and theexpression cassette B are integrated to the same expression carrier, the expression carrier is converted into a hybrid rice seed through an agrobacterium-mediated method to obtain a T0-geneation plant; and the T0-geneation plant is subjected to selfing to obtain a selfed seed. According to the method disclosed by the invention, a rice nucellus tissue is used for specifically expressing the promoter, and a rice embryo forming key gene is subjected to specific expression in the hybrid rice nucellus tissue to induce a nucellus tissue somatic cell to form an adventitious embryo; the rice zygoticembryo development key gene is knocked out to damage a sexual reproduction process of the rice; and finally, through hybrid rice selfing, a seed capable of realizing rice heterosis fixation through asomatic cell adventitious embryo way is formed. According to the method, hybrid rice grouping efficiency can be greatly improved, and seed production does not need to be carried out in each year.

Description

technical field [0001] The invention relates to the field of agricultural biotechnology, in particular to a method for realizing rice heterosis fixation. Background technique [0002] Rice heterosis utilization technology was first successfully applied in my country. After more than 40 years of development, it has made great achievements and provided an important guarantee for my country's food self-sufficiency. At the same time, hybrid rice is also used in Southeast Asia, India, the United States and other countries and regions in the world It has been widely used in production and has been identified by the Food and Agriculture Organization of the United Nations as the preferred technology to solve food shortages in developing countries. Therefore, hybrid rice has and will continue to provide an important guarantee for world food security. The hybrid rice currently used in production is mainly "three-line hybrid rice" based on nuclear-cytoplasmic interaction sterility and "...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00A01H6/46
CPCC12N15/8213
Inventor 赵炳然吕启明张秀丽毛毕刚唐丽黄志远郑文杰
Owner HUNAN HYBRID RICE RES CENT