Method for realizing rice heterosis fixation
A technology for heterosis and rice, applied in the field of agricultural biology, can solve the problems of inability to fix with heterosis, unable to produce seeds, abnormal development of rice embryos, etc., and achieve the effect of eliminating the risk of breeding seeds and improving the efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] A method for realizing rice heterosis fixation, comprising the following steps:
[0043] (1) Construction of a vector (expression box A) for specifically expressing the BBM1 gene in rice nucellus: the OsMADS13 promoter was connected to the coding sequence of the rice BBM1 gene, and constructed into the plant binary expression vector pCAMBIA1300. The specific construction method is:
[0044] 1.1. Design primer pairs according to the promoter sequence of OsMADS13 gene.
[0045] The DNA sequence of the promoter seq2 of the OsMADS13 gene is shown in SEQ ID NO.1, and the specific sequence is:
[0046] gatgtctaaatagctataaatgggtaagcaagatagcaaagaaggccagtggcctttgcagctaagctagctagctagcccttcttcctctctttcctgctttccctttgccttctcctattaatcctctgcacctcacacagcagcagaaaacccaccaactggagctctcctttcctactccaagaaacgaaggtagagaaagaaagatcagatcagcttcaggaccaattttagctaggttatatatctctttgcgtgctaatgtgttttagttatctgggtgtgtgtagagttctttgttaaggcactgattcagctgcagtttagattcaagtttgtatgttctctctttgaggaaaagaaacccttttcctgt...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com