SSR primer for identifying purity of seed of fruit CucumissativusL. Lvmei No.1 and method
A fruit cucumber, SSR17922-F technology, applied in the field of SSR marking, can solve the problems of long identification time and large environmental impact, and achieve the effect of avoiding long identification period, clear bands and strong commercial application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] This embodiment provides a kind of primer SSR17922 for identifying the purity of fruit cucumber Lvmei No. 1, the primer includes the upstream primer SSR17922-F and the downstream primer SSR17922-R of the primer SSR17922, the nucleotide of the upstream primer SSR17922-F The sequence is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer SSR17922-R is shown in SEQ ID NO.2.
[0029] The concrete nucleotide sequence of above-mentioned primer is as follows:
[0030] Upstream primer SSR17922-F: 5'- CATTCTAGGTCAATGAATCGCA -3' (SEQ ID NO.1)
[0031] Downstream primer SSR17922-R: 5'- GCAAAGTTGCCACATTGAAG -3' (SEQ ID NO.2)
[0032] Using the primer SSR17922 for PCR amplification, a specific band of about 197bp can be amplified in the male parent of Lvmei No. 1, and a specific band of about 182bp can be amplified in the female parent, while in the F1 green A heterozygous band of 182 / 197bp was amplified in US 1 ( figure 1 );
[0033] The nucleotide seque...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com

