Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

HIPK2 gene expression inhibitor, kit and application thereof

A gene expression and inhibitor technology, applied in the field of drug development, to achieve the effect of improving heart function

Active Publication Date: 2020-08-11
SHANGHAI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no other invention about the diagnosis and treatment of heart failure induced by long-term ischemia by HIPK2.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HIPK2 gene expression inhibitor, kit and application thereof
  • HIPK2 gene expression inhibitor, kit and application thereof
  • HIPK2 gene expression inhibitor, kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Using the CRISPR target of saCas9 (SEQ ID NO.1) designed by Visuntech: AAGTTCCAACTGGGACATGACTGGGT, the exon exon3 of the HIPK2 transcript was knocked out, and the strain was 56 bases missing (SEQ ID NO.2) TGGGTACGGCTCCCACAGCAAAGTGTACAGCCAGAGCAAGAACATAC CACCTTCTC mutant heterozygous Hipk2(+ / -) mice were bred to obtain Hipk2(- / -) mice.

[0041] The mRNA levels of HIPK2 knockout mice and non-knockout mice (WT) were determined using the following primer assays:

[0042] M-HIPK2-KD-F (SEQ ID NO.3): TGTACAGCCAGAGCAAGAACA;

[0043] M-HIPK2-KD-R (SEQ ID NO.4): TCTTGCGCTTGAGTCCACAT;

[0044] Mouse-18S-F (SEQ ID NO.5): TCAAGAACGAAAGTCGGAGG;

[0045] Mouse-18S-R (SEQ ID NO. 6): GGACATCTAAGGGCATCAC.

[0046] The results are shown in Table 1 and figure 2 As shown, each row in Table 1 represents the detection data of a group of different mouse experiments. After knocking out the HIPK2 transcript, the mRNA expression of HIPK2 can be effectively inhibited.

[0047] Table 1 mRNA l...

Embodiment 2

[0050] 1. Isolation and culture of neonatal rat cardiomyocytes and fibroblasts

[0051] Select newborn SD rats and perform the following operations:

[0052] a) Take the heart. Disinfect the chest and abdomen skin with 75% alcohol, irradiate the ultra-clean bench with ultraviolet rays for 30 minutes in advance, kill the rats on the ultra-clean bench and take the heart, remove the connective tissue and atrium, put the heart on ice, rinse with 1×ADS, and Squeeze out the blood.

[0053] b) digestion. Transfer the blood-squeezed tissue to an ampoule, chop it into pieces to 1-2 mm, and cut it into a homogenate. Prepare a 250ml sterilized glass bottle or beaker, and add the shredded mixture and trypsin collagenase digestion solution successively. When adding the enzyme solution, use a 10ml electric gun to blow and beat several times to make the enzyme and the tissue block contact completely. Place in a shaker at 37°C (rotational speed: 90-120rpm) and shake for 10 minutes. After ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an HIPK2 gene expression inhibitor, a kit and application thereof, and relates to the technical field of drug development. The invention provides the HIPK2 gene expression inhibitor and the kit, and application of the inhibitor and the kit in preparation of drugs for preventing and / or treating heart failure, and also provides the drugs for preventing and / or treating heart failure. Through verification, the inhibitor can inhibit HIPK2 expression, and also has the effect of improving cardiac functions, so that the inhibitor can be applied to diagnosis of heart failure or development of the drugs for inhibiting heart failure.

Description

technical field [0001] The invention belongs to the technical field of drug development, and in particular relates to an inhibitor of HIPK2 gene expression, a kit and an application thereof. Background technique [0002] Pathological myocardial hypertrophy is common in disease states such as hypertension and coronary heart disease, and is the terminal state of many heart diseases, which can lead to cardiac fibrosis and heart failure. Heart failure is known as the unconquered iceberg in the field of cardiology, and it is also the last battleground. In order to improve heart function and prevent complications caused by pathological myocardial hypertrophy, diuretics, RAAS inhibitors, β-blockers, and angiotensin receptor-neprilysin inhibitors (LCZ696) are usually used clinically. and other drugs. But apart from a heart transplant, there is currently no known cure. According to statistics, patients with cardiovascular disease in my country are hospitalized 2.4 times a year on ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/496A61K31/4178A61P9/04G01N33/573
CPCA61K31/4178A61K31/496A61P9/04G01N33/573G01N2333/912G01N2800/321G01N2800/324G01N2800/325A61K2300/00
Inventor 肖俊杰贝毅桦黄珍珍段祎吕毅成
Owner SHANGHAI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com