Low-toxicity cucumber mosaic virus vector, construction method and application
The technology of a cucumber mosaic virus and a construction method is applied in the field of vector construction and can solve the problems such as the inability of the cucumber mosaic virus vector to infect, the lack of expression of virulence symptoms in common cultivated tobacco, and the like.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] 1. Design upstream and downstream primers using the CMVF209 sequence as a template, and add Nco I polyclonal restriction site sequence and Stu I polyclonal restriction site sequence;
[0069] Primer NcoIF with Nco I multiple cloning restriction site sequence:
[0070] catg ccatggctgagtttgcctg;
[0071] Primer 2aORF1R with Stu I multiple cloning restriction site sequence added:
[0072] gaaggcctaatgatctcgtgtagagggatctcgatgcttgccaTtctaattctttcgctgtttgttg.
[0073] 2. Using the original pCB-CMVF209 plasmid as a template, use the following PCR amplification system to amplify and synthesize the PCR product, digest the PCR product with Nco I and Stu I, purify it, and prepare the digested product of the PCR product missing the 2b gene sequence .
[0074] The PCR amplification system is:
[0075]
[0076] The PCR amplification program is:
[0077] Pre-denaturation: 94°C for 3min; denaturation: 94°C for 30sec, 56°C for 30sec, 72°C for 60sec, a total of 35 cycles; exten...
Embodiment 2
[0087] 1. Design upstream and downstream primers using CMVF209 as a template, and add Nco I multiple cloning restriction site sequence and StuI multiple cloning restriction site sequence respectively;
[0088] Primer NcoIF with Nco I multiple cloning restriction site sequence:
[0089] catgccatggctgagtttgcctg;
[0090] Primer 2aORF1R with Stu I multiple cloning restriction site sequence added:
[0091] gaaggcctccgttccaactttcgaatgatctcgtgtagagggatctcgatgcttgccattctaattctttcgctgtttgttg;
[0092] 2. Use the original pCB-CMVF209 plasmid as a template to amplify and synthesize the PCR product, digest the PCR product with Nco I and Stu I, purify it, and prepare the digested product of the PCR product with the deletion of the 2b gene sequence. For the amplification system, please refer to the implementation example 1.
[0093] 3. Design the forward primer 2bORF333F with multiple cloning restriction sites Stu I, Spe I, Apa I, BamH I:
[0094] aaggcctggactagtgggcccgggatccaacctcccct...
Embodiment 3
[0102] 1. Design upstream and downstream primers using the CMVF209 sequence as a template, and add Nco I polyclonal restriction site sequence and Stu I polyclonal restriction site sequence;
[0103] Primer NcoIF with Nco I multiple cloning restriction site sequence:
[0104] catgccatggctgagtttgcctg;
[0105] Primer 2aORF1R with Stu I multiple cloning restriction site sequence added:
[0106] cgacgcgttcaaggcctgtgtagagggatctcgatgcttgccattctaattctttcgctgtttgttg.
[0107] 2. Use the original pCB-CMVF209 plasmid as a template to amplify and synthesize the PCR product, digest the PCR product with Nco I and Stu I, purify it, and prepare the digested product of the PCR product with the deletion of the 2b gene sequence. For the amplification system, please refer to the implementation example 1.
[0108] 3. Design the forward primer 2bORF333F with multiple cloning restriction sites Stu I, Spe I, Apa I, BamH I:
[0109] tagaaggcctggactagtgggcccgggatccaacctccccttccgcatct;
[0110] Re...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


