Unlock instant, AI-driven research and patent intelligence for your innovation.

Low-toxicity cucumber mosaic virus vector, construction method and application

The technology of a cucumber mosaic virus and a construction method is applied in the field of vector construction and can solve the problems such as the inability of the cucumber mosaic virus vector to infect, the lack of expression of virulence symptoms in common cultivated tobacco, and the like.

Inactive Publication Date: 2020-11-24
HUNAN UNIV OF HUMANITIES SCI & TECH
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The main purpose of the present invention is to provide a low-virulence cucumber mosaic virus vector, construction method and application, to solve the technical problem that the existing cucumber mosaic virus vector cannot infect common cultivated tobacco and does not express virulence symptoms

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Low-toxicity cucumber mosaic virus vector, construction method and application
  • Low-toxicity cucumber mosaic virus vector, construction method and application
  • Low-toxicity cucumber mosaic virus vector, construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] 1. Design upstream and downstream primers using the CMVF209 sequence as a template, and add Nco I polyclonal restriction site sequence and Stu I polyclonal restriction site sequence;

[0069] Primer NcoIF with Nco I multiple cloning restriction site sequence:

[0070] catg ccatggctgagtttgcctg;

[0071] Primer 2aORF1R with Stu I multiple cloning restriction site sequence added:

[0072] gaaggcctaatgatctcgtgtagagggatctcgatgcttgccaTtctaattctttcgctgtttgttg.

[0073] 2. Using the original pCB-CMVF209 plasmid as a template, use the following PCR amplification system to amplify and synthesize the PCR product, digest the PCR product with Nco I and Stu I, purify it, and prepare the digested product of the PCR product missing the 2b gene sequence .

[0074] The PCR amplification system is:

[0075]

[0076] The PCR amplification program is:

[0077] Pre-denaturation: 94°C for 3min; denaturation: 94°C for 30sec, 56°C for 30sec, 72°C for 60sec, a total of 35 cycles; exten...

Embodiment 2

[0087] 1. Design upstream and downstream primers using CMVF209 as a template, and add Nco I multiple cloning restriction site sequence and StuI multiple cloning restriction site sequence respectively;

[0088] Primer NcoIF with Nco I multiple cloning restriction site sequence:

[0089] catgccatggctgagtttgcctg;

[0090] Primer 2aORF1R with Stu I multiple cloning restriction site sequence added:

[0091] gaaggcctccgttccaactttcgaatgatctcgtgtagagggatctcgatgcttgccattctaattctttcgctgtttgttg;

[0092] 2. Use the original pCB-CMVF209 plasmid as a template to amplify and synthesize the PCR product, digest the PCR product with Nco I and Stu I, purify it, and prepare the digested product of the PCR product with the deletion of the 2b gene sequence. For the amplification system, please refer to the implementation example 1.

[0093] 3. Design the forward primer 2bORF333F with multiple cloning restriction sites Stu I, Spe I, Apa I, BamH I:

[0094] aaggcctggactagtgggcccgggatccaacctcccct...

Embodiment 3

[0102] 1. Design upstream and downstream primers using the CMVF209 sequence as a template, and add Nco I polyclonal restriction site sequence and Stu I polyclonal restriction site sequence;

[0103] Primer NcoIF with Nco I multiple cloning restriction site sequence:

[0104] catgccatggctgagtttgcctg;

[0105] Primer 2aORF1R with Stu I multiple cloning restriction site sequence added:

[0106] cgacgcgttcaaggcctgtgtagagggatctcgatgcttgccattctaattctttcgctgtttgttg.

[0107] 2. Use the original pCB-CMVF209 plasmid as a template to amplify and synthesize the PCR product, digest the PCR product with Nco I and Stu I, purify it, and prepare the digested product of the PCR product with the deletion of the 2b gene sequence. For the amplification system, please refer to the implementation example 1.

[0108] 3. Design the forward primer 2bORF333F with multiple cloning restriction sites Stu I, Spe I, Apa I, BamH I:

[0109] tagaaggcctggactagtgggcccgggatccaacctccccttccgcatct;

[0110] Re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a low-toxicity cucumber mosaic virus vector, a construction method and an application. The low-toxicity cucumber mosaic virus vector comprises a 2b genetic sequence deleted pCB-CMVF209-no2b sequence and an amino acid coding sequence 9-17aa connected to the pCB-CMVF209-no2b sequence; and a nucleotide sequence of the 9-17aa comprises at least 27 continuous bases in a sequenceas shown in SEQ ID NO.1. The low-toxicity cucumber mosaic virus vector provided by the invention can infect host plants represented by common cultivated tobaccos and does not show toxicity symptoms.

Description

technical field [0001] The invention relates to the technical field of vector construction, in particular to a low-virulence cucumber mosaic virus vector, a construction method and application. Background technique [0002] Cucumber mosaic virus (CMV) has a wide range of hosts, and there are many strains, which produce symptoms of different severity on different plants. In the prior art, several viral expression vectors have been developed by cucumber mosaic virus. However, in the existing CMV virus expression vectors, some virus vectors can only be expressed on the host plants of individual species, and cannot systemically infect some host plant plants. For example: Matsuo K et al., Xiang Zhidan et al. developed a CMV vector that completely deleted the 2b gene sequence, which can only be used to systemically infect N. The virus content of common cultivated tobacco (Nicotiana tabacum) plants was low or even undetectable. Other CMV viral expression vectors produce virulenc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/83C12N15/66A01H5/00A01H6/82
CPCC07K14/415C12N15/8203
Inventor 竺锡武谢锋华吴娟何丽华陈友倩
Owner HUNAN UNIV OF HUMANITIES SCI & TECH