Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific DNA (deoxyribonucleic acid) molecular marker of trichiurus punctatus and application thereof

A technology of DNA molecules and three pieces of fish, applied in the direction of recombinant DNA technology, DNA / RNA fragments, applications, etc., can solve the problems of easy hybridization, long cycle time, and difficult operation, so as to avoid germplasm mixing, improve purity, The effect of improving stability

Active Publication Date: 2021-01-29
HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Because the fishes of the genus Sankuai are very similar in shape, it is difficult to distinguish, and they are prone to hybridization and germplasm mixing. However, the traditional means of screening and germplasm purification are time-consuming and difficult to operate. Therefore, there is an urgent need Purify the three-cup fish with impure germplasm, scientifically guide the multiplication and release of three-cup fish, and ensure the purity of the three-cup germplasm and the sustainable utilization of natural wild resources

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific DNA (deoxyribonucleic acid) molecular marker of trichiurus punctatus and application thereof
  • Specific DNA (deoxyribonucleic acid) molecular marker of trichiurus punctatus and application thereof
  • Specific DNA (deoxyribonucleic acid) molecular marker of trichiurus punctatus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0063] Embodiment 2 Zhuxing three-piece fish DNA barcode and primers thereof

[0064] The DNA barcode sequence of Zhuxing three piece fish is as follows (SEQ ID NO:4):

[0065] GGGGACCGCTTTAAGCCTTCTCATTCGGGCTGAATTAAGTCAACCCGGGTCACTTCTAGGTGACGACCAAATTTATAACGTTATTGTTACTGCCCACGCCTTCGTAATAATTTTCTTTATAGTGATGCCAATTCTTATCGGAGGATTTGGAAATTGACTGGTGCCACTAATGATTGGGGCACCTGACATGGCATTCCCCCGAATAAATAATATAAGCTTCTGACTACTACCGCCATCATTCCTACTACTACTAGCCTCTTCTGGCGTTGAAGCCGGAGCTGGGACAGGATGAACAGTATACCCACCACTTGCAGGCAACCTCGCCCACGCAGGAGCATCAGTAGACTTAACAATCTTCTCTTTACATCTGGCAGGTGTATCATCTATCCTAGGGGCAGTAAATTTTATTACTACAATTATTAATATGAAACCCCCAGCCATCTCCCAGTACCAAACACCCTTATTTGTATGGTCCGTACTCGTAACAGCCGTCCTCCTCCTTCTGTCGCTACCAGTCCTAGCTGCCGGAATTACAATGCTCCTTACAGACCGTAACCTAAACACTACATTCTTTGACCCAGCAGGCGGAGGCGACCCAATTCTGTATCAACACCTATTCTGATTCTTTGGTC。

[0066] The primer sequences for the amplification of the Zhuxing Sankuai fish DNA barcode sequence are as follows:

[0067] COI-F (SEQ ID NO:5): 5'-TCAACCAACCACAAAGACATTGGCAC-3';...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a specific DNA (deoxyribonucleic acid) molecular marker and a DNA bar code of trichiurus lepturus and a method for quickly identifying and purifying germplasm of trichiurus lepturus. Aiming at an existing problem of germplasm mixing of the triplophysa zuellii, stable triplophysa zuellii germplasm resources are finally screened out through phenotypic screening, DNA bar code screening and triplophysa zuellii specific DNA molecular marker screening and identification. The method for rapidly purifying the germplasm of the trichiurus punctatus is simple to operate, high in accuracy, short in period, good in stability and high in germplasm purity, and provides technical support for germplasm protection, reasonable utilization and germplasm biodiversity.

Description

technical field [0001] The invention relates to a method for purifying fish germplasm, in particular to a method for the specific DNA molecular marker of Zhuxing three-piece fish, its variety identification and rapid germplasm purification. Background technique [0002] Tribolodon is the general designation of several indigenous economic species of Cyprinidae, Cyprinidae, and Arrow subfamily Tribolodon. It is mainly distributed in the Sea of ​​Japan and some inland freshwater rivers in the northwest of the Pacific Ocean. Migratory carps. In my country, it is only distributed in the Suifenhe and Tumen River basins. Three piece fish is a traditional rare fish with tender meat and delicious meat. The content of essential amino acids such as methionine and lysine in meat is higher than that of ordinary fish, and it is rich in unsaturated fatty acids, vitamin A, vitamin D, etc. Studies have proved that three pieces of fish contain a kind of polysaccharide mucin, which can promo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12N15/11A01K61/10
CPCC12Q1/6888A01K61/10C12Q2600/124Y02A40/81
Inventor 常玉梅梁利群赵雪飞孙博张立民
Owner HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com