Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-CTLA4 and anti-PD-1 bispecific antibody and application thereof

A bispecific antibody, PD-1 technology, applied in the field of tumor therapy and molecular immunology, can solve the problems of long-term disease control and low survival rate

Pending Publication Date: 2021-02-02
AKESO PHARMA INC
View PDF11 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0021] However, the disease of many tumor patients cannot be controlled for a long time after receiving chemotherapy drugs, and the 5-year survival rate is still very low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-CTLA4 and anti-PD-1 bispecific antibody and application thereof
  • Anti-CTLA4 and anti-PD-1 bispecific antibody and application thereof
  • Anti-CTLA4 and anti-PD-1 bispecific antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example 1

[0329]Preparation Example 1: Sequence design of anti-CTLA4 antibody

[0330]The amino acid sequences of the heavy chain and light chain of the anti-CTLA4 antibody 4G10 and its humanized antibodies 4G10H1L1, 4G10H3L3, and the coding nucleic acid sequence are the same as those of 4G10, 4G10H1L1, 4G10H3L3 in Chinese Patent Publication CN 106967172A, respectively.

[0331](1) 4G10 heavy chain variable region sequence and light chain variable region sequence

[0332]Nucleic acid sequence of heavy chain variable region: (372bp)

[0333]CAGGTCAAGCTGCAGGAGTCTGGACCTGAGCTGGTGAAGCCTGGAGCTTCAATGAAGATATCCTGCAAGGCTTCTGGTTACTCATTCACTGGCTACACCATGAACTGGGTGAAGCAGAGCCATGGAAAGAACCTTGAATGGATTGGACTTATTAATCCTTACAATAATATTACTAACTACAACCAGAAGTTCATGGGCAAGGCCACATTTACTGTAGACAAGTCATCCAGCACAGCCTACATGGAACTCCTCAGACTGACATCTGAAGACTCTGGAGTCTATTTCTGTGCAAGACTCGACTATAGGTCTTATTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCAGCCAAAACGACACCCCCATCTGTCTAT (SEQ ID NO: 1)

[0334]The encoded amino acid sequence: (124aa)

[0335]QVKLQESGPELVKPGASMKISCKASGYSFTGYTM...

preparation example 2

[0358]Preparation Example 2: Sequence design of anti-PD-1 antibody 14C12 and its humanized antibody 14C12H1L1

[0359]The amino acid sequence of the heavy chain and the light chain of the anti-PD-1 antibody 14C12 and its humanized antibody 14C12H1L1 and the coding nucleic acid sequence are the same as those of 14C12 and 14C12H1L1 in Chinese Patent Publication CN106967172A, respectively.

[0360](1) 14C12 heavy chain variable region sequence and light chain variable region sequence

[0361]Nucleic acid sequence of heavy chain variable region: (354bp)

[0362]GAGGTCAAACTGGTGGAGAGCGGCGGCGGGCTGGTGAAGCCCGGCGGGTCACTGAAACTGAGCTGCGCCGCTTCCGGCTTCGCCTTTAGCTCCTACGACATGTCATGGGTGAGGCAGACCCCTGAGAAGCGCCTGGAATGGGTCGCTACTATCAGCGGAGGCGGGCGATACACCTACTATCCTGACTCTGTCAAAGGGAGATTCACAATTAGTCGGGATAACGCCAGAAATACTCTGTATCTGCAGATGTCTAGTCTGCGGTCCGAGGATACAGCTCTGTACTATTGTGCAAACCGGTACGGCGAAGCATGGTTTGCCTATTGGGGACAGGGCACCCTGGTGACAGTCTCTGCC (SEQ ID NO: 13)

[0363]The encoded amino acid sequence: (118aa)

[0364]EVKLVESGGGLVKPGGSLKLSCA...

preparation example 3

[0386]Preparation Example 3: Sequences of bifunctional antibodies BiAb001 (M), BiAb002 (M), BiAb003 (M) and BiAb004 (M)design

[0387]The bifunctional antibodies BiAb001(M), BiAb002(M), BiAb003(M) and BiAb004(M) are in Morrison mode (IgG-scFv), that is, the C-terminals of the two heavy chains of an IgG antibody are connected by The fragment is connected to the scFv fragment of another antibody, and the design composition of its heavy chain and light chain is shown in Table A below.

[0388]Table A: Sequence design of BiAb001 (M), BiAb002 (M), BiAb003 (M) and BiAb004 (M)

[0389]

[0390]

[0391]In Table A above:

[0392]The amino acid sequence of Linker1 is (GGGGS) 3 (SEQ ID NO: 25)

[0393]The amino acid sequence of Linker2 is (GGGGS) 4 (SEQ ID NO: 26)

[0394]In addition, in Table A above, among the scFv fragments of BiAb001 (M), BiAb002 (M), BiAb003 (M) and BiAb004 (M) antibodies, 4G10H1V (M), 4G10L1V (M), 4G10H3V (M), 4G10L3V ( M) is based on 4G10H1V, 4G10L1V, 4G10H3V, 4G10L3V, mutations of individual...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of tumor treatment and molecular immunology, and relates to an anti-CTLA4 and anti-PD1 bispecific antibody and application thereof. Specifically, the anti-CTLA4 andanti-PD1 bifunctional antibody comprises a first protein functional region targeting PD-1 and a second protein functional region targeting CTLA4, wherein according to an EU numbering system, a heavy chain constant region of immunoglobulin contained in the bispecific antibody mutates at any two or three of a 234th site, a 235th site and a 237th site, and after mutation, the affinity constant of thebispecific antibody and Fc[gamma]RIIIa and / or C1q is reduced compared with that before mutation. The bifunctional antibody disclosed by the invention can be well and specifically combined with CTLA4and PD-1, specifically relieves the immunosuppression of the CTLA4 and the PD-1 on the body, activates T lymphocytes and has a good application prospect.

Description

Technical field [0001] The invention belongs to the fields of tumor treatment and molecular immunology, and relates to an anti-CTLA4-anti-PD-1 bispecific antibody and its use. Specifically, the present invention relates to a mutant anti-CTLA4-anti-PD-1 bispecific antibody. Background technique [0002] The transmembrane receptor PD-1 (programmed cell death-1) is a member of the CD28 gene family and is expressed on activated T cells, B cells and myeloid cells. The ligands of PD-1, PDL1 (Programmed cell death 1 ligand 1, also referred to as PDL-1) and PDL2 (Programmed cell death 1 ligand 2, also referred to as PDL-2), both belong to the B7 superfamily, among which PDL1 is used in a variety of It is expressed on all cells, including T cells, B cells, endothelial cells and epithelial cells, while PDL2 is only expressed on antigen-presenting cells such as dendritic cells and macrophages. [0003] The PD-1 / PDL1 signaling pathway plays an important role in regulating immune toler...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/46C12N15/13A61K39/395A61K45/00A61P35/00A61P35/02A61P7/06G01N33/68G01N33/574
CPCC07K16/2818A61K45/05A61P35/00A61P35/02A61P7/06G01N33/57484G01N33/6872G01N33/6893C07K2317/31C07K2317/56C07K2317/565C07K2317/622C07K2317/732C07K2317/92G01N2333/70521G01N2800/02A61K2039/505C07K2317/524C07K2317/52C07K2317/71A61K39/3955C07K2317/73C07K16/468G01N33/57492G01N2800/22C07K2319/00C07K2319/30A61K45/06A61K31/47A61K31/4709A61K2300/00A61K39/395G01N33/577A61K45/00C07K16/46C12N15/62C07K16/28G01N33/574C12N15/63G01N33/68A61K31/475A61K2039/545
Inventor 夏瑜王忠民张鹏李百勇
Owner AKESO PHARMA INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com