Anti-PD-1 antibody and medical application thereof

An antibody and drug technology, applied in the field of tumor treatment and molecular immunology, which can solve the problems of uncontrolled disease and low survival rate for a long time

Active Publication Date: 2021-02-02
CTTQ AKESO (SHANGHAI) BIOMED TECH CO LTD
View PDF17 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0020] However, the disease of many tumor patients cannot be controlled for a long time after receiving chemotherapy drugs, and the 5-year survival rate is still very low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-PD-1 antibody and medical application thereof
  • Anti-PD-1 antibody and medical application thereof
  • Anti-PD-1 antibody and medical application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example 1

[0231] Preparation Example 1: Sequence design of anti-PD-1 antibody 14C12 and its humanized antibody 14C12H1L1 (hG1WT)

[0232] The amino acid sequences of the heavy and light chains of the anti-PD-1 antibody 14C12 and its humanized antibody 14C12H1L1 (hG1WT), as well as the coding nucleic acid sequence, are completely identical to 14C12 and 14C12H1L1 in Chinese Patent Publication CN 106967172A (or CN 106977602A) .

[0233] (1) Heavy chain variable region sequence and light chain variable region sequence of 14C12

[0234] Nucleic acid sequence of 14C12 heavy chain variable region: (354bp)

[0235] GAGGTCAAACTGGTGGAGAGCGGCGGCGGGCTGGTGAAGCCCGGCGGGTCACTGAAACTGAGCTGCGCCGCTTCCGGCTTCGCCTTTAGCTCCTACGACATGTCATGGGTGAGGCAGACCCCTGAGAAGCGCCTGGAATGGGTCGCTACTATCAGCGGAGGCGGGCGATACACCTACTATCCTGACTCTGTCAAAGGGAGATTCACAATTAGTCGGGATAACGCCAGAAATACTCTGTATCTGCAGATGTCTAGTCTGCGGTCCGAGGATACAGCTCTGTACTATTGTGCAAACCGGTACGGCGAAGCATGGTTTGCCTATTGGGGACAGGGCACCCTGGTGACAGTCTCTGCC(SEQ ID NO:1)

[0236] Amino...

preparation example 2

[0259] Preparation Example 2: Sequence Design of Humanized Antibody 14C12H1L1 (hG4)

[0260] The heavy chain variable region and light chain variable region are the same as 14C12H1L1 (hG1WT), and Ig gamma-4chainC region, ACCESSION: P01861.1 is used as the heavy chain constant region, and Ig kappa chain C region, ACCESSION: P01834 is used as the light chain constant Region, and then the antibody 14C12H1L1 (hG4) was obtained. The sequence of 14C12H1L1(hG4) is as follows:

[0261] Nucleic acid sequence of 14C12H1L1 (hG4) heavy chain: (1335bp)

[0262]GAAGTGCAGCTGGTCGAGTCTGGGGGAGGGCTGGTGCAGCCCGGCGGGTCACTGCGACTGAGCTGCGCAGCTTCCGGATTCGCCTTTAGCTCCTACGACATGTCCTGGGTGCGACAGGCACCAGGAAAGGGACTGGATTGGGTCGCTACTATCTCAGGAGGCGGGAGATACACCTACTATCCTGACAGCGTCAAGGGCCGGTTCACAATCTCTAGAGATAACAGTAAGAACAATCTGTATCTGCAGATGAACAGCCTGAGGGCTGAGGACACCGCACTGTACTATTGTGCCAACCGCTACGGGGAAGCATGGTTTGCCTATTGGGGGCAGGGAACCCTGGTGACAGTCTCTAGTGCCAGCACCAAAGGGCCCTCGGTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCCGAGAGCACAGCCGCCCTGGGCTG...

preparation example 3

[0267] Preparation Example 3: Sequence Design of Humanized Antibody 14C12H1L1 (hG1TM)

[0268] Based on the 14C12H1L1 (hG1WT) obtained in Preparation Example 1, the inventors introduced a leucine-alanine point at the 234th position of the heavy chain hinge region according to the EU numbering system. mutation (L234A), a point mutation from leucine to alanine (L235A) was introduced at the No. 235 site, and a point mutation from glycine to alanine (G237A) was introduced at the No. 237 site, and the mutant human Derivation of 14C12H1L1(hG1TM).

[0269] Nucleic acid sequence of 14C12H1L1 (hG1TM) heavy chain: (1344bp)

[0270] GAAGTGCAGCTGGTCGAGTCTGGGGGAGGGCTGGTGCAGCCCGGCGGGTCACTGCGACTGAGCTGCGCAGCTTCCGGATTCGCCTTTAGCTCCTACGACATGTCCTGGGTGCGACAGGCACCAGGAAAGGGACTGGATTGGGTCGCTACTATCTCAGGAGGCGGGAGATACACCTACTATCCTGACAGCGTCAAGGGCCGGTTCACAATCTCTAGAGATAACAGTAAGAACAATCTGTATCTGCAGATGAACAGCCTGAGGGCTGAGGACACCGCACTGTACTATTGTGCCAACCGCTACGGGGAAGCATGGTTTGCCTATTGGGGGCAGGGAACCCTGGTGACAGTCTCTAGTGCCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of tumor treatment and molecular immunology, and relates to an anti-PD-1 antibody and medical application thereof. Specifically, the invention relates to a monoclonal antibody. A heavy chain variable region of the monoclonal antibody comprises CDR with amino acid sequences of SEQ ID NOs:19-21; and / or a light chain variable region of the monoclonal antibody comprises CDR with amino acid sequences of SEQ ID NOs:22-24, wherein a heavy chain constant region of the antibody mutates at any two or three of a 234th site, a 235th site and a 237th site according to anEU numbering system, and the affinity constant of the mutated antibody and Fc[gamma]RIIIa and / or C1q is reduced compared with that before mutation. The monoclonal antibody can be well and specificallycombined with PD-1, specifically relieves the immunosuppression of the PD-1 on the body, and activates T lymphocytes.

Description

technical field [0001] The invention belongs to the fields of tumor treatment and molecular immunology, and relates to an anti-PD-1 antibody and its medical application. Specifically, the present invention relates to a mutated anti-PD-1 antibody. Background technique [0002] Transmembrane receptor PD-1 (programmed cell death 1, also referred to as PD-1) is a member of the CD28 gene family, expressed in activated T cells, B cells and myeloid cells . The ligands of PD-1, PDL1 (Programmed cell death 1ligand 1, also referred to as PDL-1) and PDL2 (Programmed cell death1ligand 2, also referred to as PDL-2) belong to the B7 superfamily, and PDL1 is expressed in a variety of cells , including T cells, B cells, and endothelial and epithelial cells, while PDL2 is only expressed in antigen-presenting cells such as dendritic cells and macrophages. [0003] The PD-1 / PDL1 signaling pathway plays an important role in regulating immune tolerance, microbial infection and tumor immune es...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/28A61K45/06A61K39/395A61K31/47A61K31/4709A61P35/00A61P35/02A61K51/10A61K49/00
CPCC07K16/2818A61K45/06A61K39/3955A61K31/47A61K31/4709A61P35/00A61P35/02A61K51/1027A61K49/0058C07K2317/565C07K2317/56C07K2317/52C07K2317/92C07K2317/24C07K2317/76A61K2039/505A61K2300/00A61K39/395G01N33/57492G01N2333/70596C07K2317/71C07K2317/90C07K2317/73C07K16/18A61K49/00C07K16/28G01N33/574G01N33/577G01N33/68A61K51/10C07K16/283A61P7/06A61K31/475A61K2039/545C07K2317/622G01N2333/70521
Inventor王忠民张鹏李百勇夏瑜
OwnerCTTQ AKESO (SHANGHAI) BIOMED TECH CO LTD