Check patentability & draft patents in minutes with Patsnap Eureka AI!

High-yield influenza virus preparation system and preparation method

An influenza virus, high-yield technology, applied in the high-yield influenza virus preparation system and the field of preparation, can solve the problem that the threat of influenza virus cannot be completely eliminated, and achieve the effects of increasing the titer of toxin production, increasing the yield, and optimizing the preparation

Inactive Publication Date: 2021-02-26
INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although a few antiviral drugs have a certain effect on influenza virus infection, they cannot completely eliminate the threat of influenza virus to humans, so vaccination is still an effective measure to prevent influenza

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-yield influenza virus preparation system and preparation method
  • High-yield influenza virus preparation system and preparation method
  • High-yield influenza virus preparation system and preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Establishment of MARCH8-deleted MDCK cells

[0039] 1. Method

[0040] 1.1 Establishment of MDCK cell lines lacking MARCH8

[0041] 1.1.1 Construction of lentiCRISPR-gMARCH8 plasmid

[0042] For the MARCH8 gene, design gRNA sequences through the website http: / / www.e-crisp.org / E-CRISP / , including gMARCH8#1 and gMARCH8#2.

[0043] gMARCH8#1 sequence: GTAAGACCAAAGAAAAGGAG

[0044] gMARCH8#2 sequence: GAGCTCGCAGCAGCGCGTGT

[0045] Two gRNA sequences targeting MARCH8 were introduced into lentiCRISPR-V2 by molecular cloning to obtain the lentiCRISPR-gMARCH8 plasmid.

[0046] 1.1.2 Preparation of pseudoviruses for transduction

[0047] HEK293T cells (4×10 6 ) were inoculated in a 10 cm culture plate and cultured overnight, when the cell growth density reached 60% to 70%, transfected with VSV-G, pSPAX2 plasmid and lentiCRISPR-gMARCH8 or lentiCRISPR-V2 control plasmid. After 48 hours, the pseudovirus supernatant packaged with CRISPR-gMARCH8 was harvested, centri...

Embodiment 2

[0057] Example 2 Construction of M2 mutants to obtain high-yield strains not affected by MARCH8

[0058] 1. Method

[0059] 1.1 Detection of M2 protein expression

[0060] 1.1.1 Influenza virus infection

[0061] In HEK293 (5×10 5 ) cells were transfected with MARCH8 or control plasmid Vector for 24 hours; infected with A / PR8 virus (MOI=2.0) for 8 hours.

[0062] 1.1.2 Western Blot detection of M2 total protein expression

[0063] Collect infected cells, centrifuge at 3000rpm for 3min, wash once with PBS, add 100μL cell lysate RIPA, and store at -20°C for later use. Protein samples were prepared and subjected to SDS-PAGE electrophoresis, and Western Blot was used to detect the expression of M2 protein.

[0064] 1.1.3 Flow cytometry to detect the expression of M2 protein on the plasma membrane

[0065] Collect infected cells, centrifuge at 3000rpm for 3min, wash once with PBS, bind M2 antibody at 4°C for 1h, wash once with cold PBS, Alexa Combine the goat anti-mouse flu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Titeraaaaaaaaaa
Login to View More

Abstract

The invention discloses a high-yield influenza virus preparation system and a preparation method, on one hand, MDCK cells lacking MARCH8 are used for preparing influenza viruses, the virus productiontiter is improved, and an influenza virus preparation system based on mammalian cells is optimized; on the other hand, high-yield strain with M2 mutation, which is not affected by MARCH8, is used forpreparing influenza viruses, so that the yield of the influenza virus prepared in mammalian cells and chick embryos is increased, and the method for preparing the influenza virus by utilizing the mammalian cells and the chick embryos is optimized.

Description

technical field [0001] The invention relates to the field of virus preparation methods, in particular to a high-yield influenza virus preparation system and preparation method. Background technique [0002] Influenza is one of the infectious diseases that cannot be effectively controlled by humans so far. It is characterized by sudden outbreaks in a short period of time and rapid spread, resulting in varying degrees of prevalence. In addition to infecting humans, influenza viruses also widely exist in animals and can cause diseases in pigs, chickens, horses and other animals, resulting in a large number of animal deaths. Although a few antiviral drugs have a certain effect on influenza virus infection, they cannot completely eliminate the threat of influenza virus to humans. Therefore, vaccination is still an effective measure to prevent influenza. [0003] At present, inoculation of traditional inactivated chicken embryo vaccine is still the main measure to prevent influen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N7/00C12N7/02C12N15/113C12N15/867
CPCC12N5/0686C12N7/00C12N15/113C12N15/86C12N2740/15043C12N2760/16151C12N2760/16152C12N2310/20
Inventor 郭斐刘晓满许丰雯梅珊
Owner INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More