Chimeric antigen receptor and application thereof
A chimeric antigen receptor and antigen recognition technology, applied in the direction of antibody medical components, applications, carriers, etc., can solve unclear side effects, fatal problems, etc., to improve the therapeutic effect, reduce the risk of neurotoxicity, and prevent cytokine storms Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0135] The anti-CD19 28Z CAR sequence refers to the sequence shared by the Rosenberg, S.A. laboratory at NCBI. On this basis, we used gene synthesis technology to insert the full-length intracellular segment of CD3ε into the CD28TM transmembrane region, and constructed a new CAR named E28Z .
[0136] The sequence of anti-CD19E28Z CAR is shown in SEQ ID NO:7. Specifically:
[0137] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGAC GTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACC CTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCT ACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCAT GCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCC GAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAG GACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCG ACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGC AGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCA...
Embodiment 2
[0155] Such as Figure 2a As shown, the sequence of FMC63scFv (anti-CD19) in the CD19-targeting 28Z CAR and E28Z CAR is replaced by SS1scFv (anti-mesothelin) sequentially, that is, the mesothelin-targeting 28Z CAR and E28Z CAR, respectively.
[0156]The level of CAR on the membrane surface of 28Z and E28Z CAR-T cells was detected by flow cytometry with the primary antibody Rat anti-HA and the secondary antibody goat anti-Rat IgG-Alexa Fluor647, and the results of flow cytometry were as follows: Figure 2b . shows that there is no difference in the positive rate and expression level (MFI) of CAR between the two.
[0157] Anti-mesothelin 28Z CAR-T and E28Z CAR-T cells were detected by flow cytometry with anti-human CD4-APC and anti-human CD8-PE-Cy7 antibodies, and the results of flow cytometry were as follows Figure 2c , showing both CD4 + CAR-T cells and CD8 + The proportion of CAR-T cells was similar.
[0158] 100,000 anti-mesothelin CAR-T cells and the K562-Mesothelin c...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com