Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chimeric antigen receptor and application thereof

A chimeric antigen receptor and antigen recognition technology, applied in the direction of antibody medical components, applications, carriers, etc., can solve unclear side effects, fatal problems, etc., to improve the therapeutic effect, reduce the risk of neurotoxicity, and prevent cytokine storms Effect

Active Publication Date: 2021-03-16
CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The current methods to solve cytokine storm (CRS) and neurotoxicity (NT) have limitations: clinically, Roche’s Actemra (tocilizumab, IL-6R monoclonal antibody) is mainly used to manage CRS clinically, and tocilizumab was approved by the US FDA for the first time. Approved for rheumatoid arthritis treatment that blocks the inflammatory response mediated by these cytokines
The disadvantage is that it will increase the level of IL-6 in the blood of the patient, and high concentrations of IL-6 can pass through the blood-brain barrier and induce neurotoxicity; ②IL-1 inhibitors: May 2018, from San Rafael Hospital, Italy- Two independent trials by two research teams at the San Rafael Institute of Science and MSKCC (Memorial Sloan Kettering Cancer Center) have demonstrated that CRS is triggered by the inflammatory molecule IL-1, adding IL-1 to the treatment regimen Receptor antagonist Kineret (anakinra, a rheumatoid arthritis drug) can effectively control CRS by competitively inhibiting IL-1, because it has the ability to penetrate the blood-brain barrier and can also control neurotoxicity; limitations: both tocilizumab and anakinra It is not from early intervention to prevent cellular CRS / NS, but an emergency measure, and there is a fatal risk if the remedy is not timely
And it's unclear what's the best way to intervene early when side effects occur

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor and application thereof
  • Chimeric antigen receptor and application thereof
  • Chimeric antigen receptor and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0135] The anti-CD19 28Z CAR sequence refers to the sequence shared by the Rosenberg, S.A. laboratory at NCBI. On this basis, we used gene synthesis technology to insert the full-length intracellular segment of CD3ε into the CD28TM transmembrane region, and constructed a new CAR named E28Z .

[0136] The sequence of anti-CD19E28Z CAR is shown in SEQ ID NO:7. Specifically:

[0137] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGAC GTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACC CTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCT ACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCAT GCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCC GAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAG GACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCG ACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGC AGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCA...

Embodiment 2

[0155] Such as Figure 2a As shown, the sequence of FMC63scFv (anti-CD19) in the CD19-targeting 28Z CAR and E28Z CAR is replaced by SS1scFv (anti-mesothelin) sequentially, that is, the mesothelin-targeting 28Z CAR and E28Z CAR, respectively.

[0156]The level of CAR on the membrane surface of 28Z and E28Z CAR-T cells was detected by flow cytometry with the primary antibody Rat anti-HA and the secondary antibody goat anti-Rat IgG-Alexa Fluor647, and the results of flow cytometry were as follows: Figure 2b . shows that there is no difference in the positive rate and expression level (MFI) of CAR between the two.

[0157] Anti-mesothelin 28Z CAR-T and E28Z CAR-T cells were detected by flow cytometry with anti-human CD4-APC and anti-human CD8-PE-Cy7 antibodies, and the results of flow cytometry were as follows Figure 2c , showing both CD4 + CAR-T cells and CD8 + The proportion of CAR-T cells was similar.

[0158] 100,000 anti-mesothelin CAR-T cells and the K562-Mesothelin c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a chimeric antigen receptor. The chimeric antigen receptor comprises an extracellular structural domain, a transmembrane structural domain and an intracellular structural domainwhich are connected in sequence, wherein the extracellular structural domain comprises an antigen recognition region and a hinge region; and one end of the intracellular structural domain, which is connected with the transmembrane structural domain, is connected with a CD3 epsilon intracellular region. The chimeric antigen receptor provided by the invention can further improve the treatment effect of B-cell leukemia lymphoma in B-cell leukemia lymphoma treatment, and reduces inflammatory cytokines generated by macrophage monocyte activation by down-regulating cytokines of the chimeric antigenreceptor, so that cytokine storm can be prevented at an early stage, and the risk of neurotoxicity can be reduced. The treatment effect of solid tumors with high mesothelin expression is further improved in mesothelin positive tumor treatment, and meanwhile, cytokine storm can be prevented in an early stage and the risk of neurotoxicity can be reduced.

Description

technical field [0001] The invention relates to the field of chimeric antigen receptors, in particular to a chimeric antigen receptor and its application. Background technique [0002] Chimeric antigen receptor is referred to as CAR (chimeric antigen receptor), and T cells equipped with CARs targeting specific tumor antigens are called CAR-T cells. CAR-T therapy is widely used in the treatment of tumors, but there are still many limitations, such as cytokine storms encountered in the clinical treatment of leukemia and solid tumors, neurotoxicity safety issues and curative effect needs to be improved, especially in solid tumors. application of tumor immunotherapy. [0003] The current methods to solve cytokine storm (CRS) and neurotoxicity (NT) have limitations: clinically, Roche’s Actemra (tocilizumab, IL-6R monoclonal antibody) is mainly used to manage CRS clinically, and tocilizumab was approved by the US FDA for the first time. Approved for the treatment of rheumatoid a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N5/10A61K39/00A61P35/00A61P35/02
CPCC07K16/2896C07K16/30C07K16/2821C07K14/7051C12N15/86C12N5/0636A61K39/001129A61P35/00A61P35/02C07K2319/03C07K2319/02C07K2319/33C07K2317/622C12N2510/00C12N2740/15043C12N2800/107A61K2039/5158C07K16/2803C07K2317/73C12N2740/16043C07K14/70503A61K39/4611A61K39/4631A61K39/464412A61K39/464468C12N2501/2307C12N2501/2315A61K35/17C07K14/70521C07K16/32
Inventor 许琛琦周秋萍吴微何星孙赫
Owner CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products