Cephalosporin C acylase mutant and its preparation method and application
A cephalosporin and acylase technology, applied in the field of bioengineering, can solve the problems of low enzyme activity and low industrial production efficiency, and achieve the effects of improving enzyme activity and high enzyme activity efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] (1) The gene of interest was cloned using SEQ ID NO: 4, the wild-type gene of CPC acylase, as a template. The primer sequences were: upstream primer F1: GGGAATTCCATATGCT F2: GAGAGTTCTGCACCG downstream primer R1: CCCGGAATTCTCATGG R2: CTTGAAGTTGAAGTTGAAGG, wherein F1 and R2 contained 20bp identical Homology arms, F2 and R1 contain 20bp homology arms, so as to carry out double point mutations.
[0035] (2) The PCR amplification system is as follows:
[0036]
[0037] The PCR reaction conditions were pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 45°C for 5 s, extension at 72°C for 3 min, and 30 cycles; extension at 72°C for 10 min.
[0038] (3) Subsequent purification of the PCR product was performed using a purification kit, and the obtained target gene was double-digested with BamHI and HinDIII endonucleases. For the plasmid vector PET-28a + Carry out the same double digestion to obtain the recombinant plasmid PET-28a + -CPCA. Esche...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


