Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cephalosporin C acylase mutant and its preparation method and application

A cephalosporin and acylase technology, applied in the field of bioengineering, can solve the problems of low enzyme activity and low industrial production efficiency, and achieve the effects of improving enzyme activity and high enzyme activity efficiency

Active Publication Date: 2022-05-03
SHANDONG JINCHENG KERUI CHEMICAL CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Although the enzyme activity of the cephalosporin C acylase mutant provided by the above two patents is 8.6 times and 52 times higher than that of the wild type cephalosporin C acylase, its enzyme activity is still low and the industrial production efficiency is low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cephalosporin C acylase mutant and its preparation method and application
  • Cephalosporin C acylase mutant and its preparation method and application
  • Cephalosporin C acylase mutant and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] (1) The gene of interest was cloned using SEQ ID NO: 4, the wild-type gene of CPC acylase, as a template. The primer sequences were: upstream primer F1: GGGAATTCCATATGCT F2: GAGAGTTCTGCACCG downstream primer R1: CCCGGAATTCTCATGG R2: CTTGAAGTTGAAGTTGAAGG, wherein F1 and R2 contained 20bp identical Homology arms, F2 and R1 contain 20bp homology arms, so as to carry out double point mutations.

[0035] (2) The PCR amplification system is as follows:

[0036]

[0037] The PCR reaction conditions were pre-denaturation at 98°C for 3 min; denaturation at 98°C for 10 s, annealing at 45°C for 5 s, extension at 72°C for 3 min, and 30 cycles; extension at 72°C for 10 min.

[0038] (3) Subsequent purification of the PCR product was performed using a purification kit, and the obtained target gene was double-digested with BamHI and HinDIII endonucleases. For the plasmid vector PET-28a + Carry out the same double digestion to obtain the recombinant plasmid PET-28a + -CPCA. Esche...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of bioengineering, and in particular relates to a cephalosporin C acylase mutant, a preparation method and application thereof. The cephalosporin C acylase mutant has the amino acid sequence shown in SEQ ID NO:2. The amino acid sequence shown in SEQ ID NO: 2 is obtained by performing substitution mutations on the 245-247 amino acids of the amino acid sequence shown in SEQ ID NO: 1; wherein, the 245th tyrosine is mutated into phenylalanine, Arginine at position 246 was mutated to methionine, and leucine at position 247 was mutated to serine. Compared with the wild-type GL-7-ACA acylase SED ID NO: 1 enzyme activity, the cephalosporin C acylase mutant of the present invention has improved more than 210 times, and can be applied to 7-aminocephalosporanic acid (7-aminocephalosporanic acid (7-aminocephalosporanic acid) One-step enzymatic production of ACA).

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a cephalosporin C acylase mutant, a preparation method and application thereof. Background technique [0002] 7-Aminocephalosporanic acid (7-ACA) is the main precursor for the synthesis of β-lactam antibiotics, which is mainly synthesized by chemical and enzymatic methods in industry. However, due to the complex process, serious pollution and high energy consumption of the chemical synthesis method, it has been replaced by the biological enzymatic method in recent years. The biological enzymatic method has a simple process, mild reaction conditions, and stable product quality. The chemical method is mature, and the biological enzyme method has a lot of room for improvement compared with the chemical method. With the gradual improvement of the country's requirements for green environmental protection, the biological enzyme method will have a brighter future pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/80C12N15/70C12P35/02
Inventor 王辉崔倩倩王宾刘家栋
Owner SHANDONG JINCHENG KERUI CHEMICAL CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com