Method for synthesizing L-2-piperidinecarboxylic acid through whole-cell catalysis

A pipecolinic acid and whole-cell technology, which is applied in the field of whole-cell catalytic synthesis of L-2-piperidinecarboxylic acid, can solve the problems of low pipA enzyme activity, low substrate concentration, and large amount of whole cells, and achieve enzyme activity High efficiency, short reaction time, and high ee value

Active Publication Date: 2017-10-24
NANJING NUOYUN BIOLOGICAL TECH CO LTD
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In this scheme, the enzyme activity of pipA is not high, resulting in the use of too much whole cells (OD=200), the substrate concentration is not high (lysine 25g / L), and the substrate needs to be added in batches to complete the reaction
These factors lead to problems such as high cost when scaled up

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing L-2-piperidinecarboxylic acid through whole-cell catalysis
  • Method for synthesizing L-2-piperidinecarboxylic acid through whole-cell catalysis
  • Method for synthesizing L-2-piperidinecarboxylic acid through whole-cell catalysis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Arenimonas donghaensis DSM 18148 was placed in LB medium, cultured at 30°C and 180 rpm for 3-5 days, the precipitate was collected by centrifugation, and the DNA of Arenimonas donghaensis DSM 18148 was extracted and purified with the DNA extraction and purification kit QiAamp Kit (Qiagen, Germany).

[0038] The Genomic DNA of Arenimonas donghaensis DSM 18148 was amplified by PCR with Pfu high-fidelity enzyme, and the primers used were

[0039] NYPD-F 5' ATGACCATGACCCAGCTCACCA 3'

[0040] NYPD-R 5' TCAGGCCGCCTGCTTGC 3'

[0041] Since the GC content of Arenimonas donghaensis DSM 18148 DNA fragment is close to 70%, betaine with a final concentration of 0.5M was added during amplification. Afterwards, the amplified fragment was treated with Taq polymerase at 72°C for 10 minutes, and base A was added to the 3' end of the DNA. Afterwards, it was connected to the pMD19T-simple (Takara Bao Biological Company, Beijing) cloning vector, and a single clone was picked and sent to ...

Embodiment 2

[0043] Due to the high GC content of the original DNA sequence, it is difficult to achieve high-efficiency transcription when cultured in host bacteria. Therefore, through the method of whole gene synthesis, the secondary structure and codon bias of the gene are adjusted to achieve high expression in Escherichia coli. Use Primer Premier (http: / / primer3.ut.ee / ) and OPTIMIZER (http: / / genomes.urv.es / OPTIMIZER / ) to design, and ensure that the Tm difference is controlled within 3°C, and the primer length is controlled within 50base , resulting in the following primers:

[0044]

[0045]

[0046] The above primers were synthesized, and the obtained primers were dissolved in double-distilled water, and then added to the following reaction system, so that the final concentration of each primer was 30 nM, and the final concentration of the first and last primers was 0.6 μM.

[0047] 2mM dNTP mix (2mM each dNTP)

5μl

10×Pfu buffer

5μl

Pfu DNA polymer...

Embodiment 3

[0051]Through the method of whole gene synthesis, the secondary structure and codon bias of the gene are adjusted to achieve high expression in Escherichia coli. Use Primer Premier (http: / / primer3.ut.ee / ) and OPTIMIZER (http: / / genomes.urv.es / OPTIMIZER / ) to design, and ensure that the Tm difference is controlled within 3°C, and the primer length is controlled within 50base , resulting in the following primers:

[0052]

[0053]

[0054] The above primers were synthesized, and the obtained primers were dissolved in double-distilled water, and then added to the following reaction system, so that the final concentration of each primer was 30 nM, and the final concentration of the first and last primers was 0.6 μM.

[0055] 2mM dNTP mix (2mM each dNTP)

5μl

10×Pfu buffer

5μl

Pfu DNA polymerase (10U / μl)

0.5μl

ddH2O

Bring the total volume of the reaction system to 50 μl

[0056] The prepared PCR reaction system was placed in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biocatalysis, and particularly relates to a method for synthesizing L-2-piperidinecarboxylic acid through whole-cell catalysis. According to the method for synthesizing L-2-piperidinecarboxylic acid through the whole-cell catalysis, L-lysine hydrochloride is used as a matrix; and by adding nicotinamide adenine dinucleotide and Arenimonas donghaensis DSM 18148 protein coding gene-containing recombinant host bacteria, or Pseudomonas veronii CIP104663 protein coding gene-containing recombinant host bacteria, or Streptomyces hirsutus ATCC 19091 protein coding gene-containing recombinant host bacteria, the L-2-piperidinecarboxylic acid is prepared through biocatalysis. Therefore, the problems of high cost, harsh condition, low conversion rate, high energy consumption and high pollution of an existing chemical synthesis method are solved. Moreover, a biocatalysis system disclosed by the invention is high in enzyme activity efficiency, short in reaction time and high in ee value of a target product.

Description

technical field [0001] The invention belongs to the technical field of biocatalysis, and in particular relates to a method for whole-cell catalytic synthesis of L-2-piperidinecarboxylic acid. Background technique [0002] L-2-piperidinecarboxylic acid is a naturally occurring non-protein configuration amino acid, which is an important chiral drug intermediate and can be used to prepare rapamycin, antineoplastic agent VX-710, immunosuppressant FK506, piperidine Alkaloids, etc., have high industrial application value. The current main production method is chemical synthesis, which has the disadvantages of low yield, high energy consumption, and large pollution. At the same time, the ee value is difficult to control. [0003] Fujii et al. used E. coli engineering bacteria recombinantly expressing L-lysine-6-aminotransferase and dihydropyrrole-5-carboxylate reductase to accumulate 3.9 g / L product in 159 hours. Subsequently, by adding lysP lysine permease and yeiE, the highest...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P17/12C12R1/19
CPCC12P17/12
Inventor朱惠霖丁雪峰陈令伟娄向弟
OwnerNANJING NUOYUN BIOLOGICAL TECH CO LTD