Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method of constructing a spontaneous rheumatoid arthritis mouse model

A rheumatoid, mouse model technology, applied in the field of animal genetic engineering, can solve problems such as affecting the quality of life of patients, large side effects, and disability.

Active Publication Date: 2022-08-05
EAST CHINA NORMAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Rheumatoid arthritis (RA) is an autoimmune disease with a high incidence rate. At present, it is believed that the main cause of its pathogenesis is the joint action of genetic factors and environmental factors, which leads to the body misidentifying self-antigens to produce autoantibodies, and a large number of immune cells infiltrate Erosion of articular cartilage and surrounding bone, resulting in continuous joint damage, joint swelling, pain, deformity and even disability, accompanied by many complications, seriously affecting the quality of life of patients
Although there are many clinical research and treatment resources for rheumatoid arthritis in recent years, there is no cure for rheumatoid arthritis. Although methotrexate, the most widely used RA drug, can effectively relieve symptoms, its The side effects are relatively large, and many patients cannot tolerate it, and other related drugs or surgical treatments are also unable to cure the disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method of constructing a spontaneous rheumatoid arthritis mouse model
  • A method of constructing a spontaneous rheumatoid arthritis mouse model
  • A method of constructing a spontaneous rheumatoid arthritis mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Using CRISPR-CAS9 technology, the mutant Syk-Ser544Tyr described in the first aspect of the present invention was site-directed and introduced into the Syk gene by homologous recombination. The specific construction method is:

[0045] 1. According to the mice retrieved from the NCBI website Syk Gene sequence and design for mouse Syk The specific DNA sequence of the sgRNA at the target mutation site of the gene is: 5'-TCCAGACGTCACTCTTAC-3' ( figure 1 above) and this sequence was then constructed into an expression vector.

[0046] 2. Synthesis of the single-stranded template: Synthesize the single-stranded template according to the following sequence. 5'CCAGACCCACGGGAAGTGGCCCGTGAAGTGGTACGCCCCCGAATGCATCAACTACTACAAGTTCTACAGCAAGAGTGACGTCTGGAGCTTCGGAGTCCTGATGTGGGAAGCGTTCTCCTA-3'.

[0047] 3. Transcribe sgRNA and CAS9 mRNA in vitro, then mix the sgRNA, CAS9 mRNA and single-stranded synthetic template according to the final concentration of 50ng / μL and inject them into f...

Embodiment 2

[0053] Validation of the phenotype of the Syk-Ser544Tyr mutant mouse model

[0054] 1. The ankle, tail thickness, front and rear paw pad thickness, and clinical score of Syk-Ser544Tyr mice were continuously monitored at the age of two weeks. As the age increased, the arthritis phenotype of the mice gradually increased: the joint swelling phenotype began to appear at the age of five weeks. , the ankles were obviously red, swollen and deformed at the age of eight weeks, the clinical score of rheumatoid arthritis in three-month-old mice reached more than 10 points, and the motor function of the mice weakened with age (the exercise ability of mice was monitored by placing the mice in an iron cage. up and overturn the cage, make the mouse stand upside down on the cage, observe its movement and record its falling time) ( figure 2 Left and right); Micro-CT scans showed that the ankle joints and caudal vertebrae of point mutant mice were severely eroded ( figure 2 middle).

[00...

Embodiment 3

[0058] SYK inhibitors treat arthritis in Syk-Ser544Tyr mutant mice

[0059] 1. One-month-old and three-month-old point mutant mice were given SYK inhibitor R406 (dissolved in 5% DMSO + 95% corn oil) by gavage at a daily dose of 10 mg / kg, and the control group was given The same dose of 5% DMSO + 95% corn oil was administered for a total of 28 days, and the arthritis scores and ankle thickness of the mice were detected every two days. It was found that R406 can effectively relieve one month ( Figure 5 left) and three months ( Figure 5 Right) Arthritis phenotype in point mutant mice.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for constructing a mouse animal model of rheumatoid arthritis. Screening based on the results of whole-genome sequencing of human patients found a point mutation in a specific site of the SYK gene and predicted that it was very likely to be a pathogenic mutation. Therefore, compared with mice Syk Gene sequence, successfully obtained using different methods Syk The genetically engineered mice with mutations at specific sites of the gene have typical rheumatoid arthritis disease characteristics, which lays a theoretical foundation for the research on the pathogenic mechanism and treatment of human rheumatoid arthritis.

Description

technical field [0001] The invention relates to the technical field of animal genetic engineering, in particular to a method for constructing a rheumatoid arthritis mouse disease model. Background technique [0002] Rheumatoid arthritis (RA) is an autoimmune disease with a high incidence. At present, it is believed that the main cause of its pathogenesis is the combined effect of genetic factors and environmental factors, resulting in the body misidentifying self-antigens and producing autoantibodies, and a large number of immune cells infiltrate. Erosion of articular cartilage and surrounding bones results in persistent joint damage, joint swelling, pain, deformity, and even disability. It is also accompanied by many complications and seriously affects the quality of life of patients. Although there are many clinical research and treatment resources for rheumatoid arthritis in recent years, there is still no cure for rheumatoid arthritis. Although methotrexate, the most use...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A01K67/027C12N15/90C12N15/12
CPCA01K67/0275C12N15/907C07K14/47A01K2227/105A01K2267/0368A01K2267/0387
Inventor 李大力曾之扬陆佳微曹希雅
Owner EAST CHINA NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com