Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method of spontaneous rheumatoid arthritis mouse model

A rheumatoid and mouse model technology, applied in the field of animal genetic engineering, can solve problems such as joint swelling, pain, deformity, and joint damage

Active Publication Date: 2021-07-06
EAST CHINA NORMAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Rheumatoid arthritis (RA) is an autoimmune disease with a high incidence rate. At present, it is believed that the main cause of its pathogenesis is the joint action of genetic factors and environmental factors, which leads to the body misidentifying self-antigens to produce autoantibodies, and a large number of immune cells infiltrate Erosion of articular cartilage and surrounding bone, resulting in continuous joint damage, joint swelling, pain, deformity and even disability, accompanied by many complications, seriously affecting the quality of life of patients
Although there are many clinical research and treatment resources for rheumatoid arthritis in recent years, there is no cure for rheumatoid arthritis. Although methotrexate, the most widely used RA drug, can effectively relieve symptoms, its The side effects are relatively large, and many patients cannot tolerate it, and other related drugs or surgical treatments are also unable to cure the disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of spontaneous rheumatoid arthritis mouse model
  • Construction method of spontaneous rheumatoid arthritis mouse model
  • Construction method of spontaneous rheumatoid arthritis mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Using CRISPR-CAS9 technology, the mutation Syk-Ser544Tyr described in the first aspect of the present invention is site-directedly introduced into the Syk gene through homologous recombination. The specific construction method is:

[0045] 1. According to the mice retrieved from the NCBI website Syk Gene sequence and design for mouse Syk The specific DNA sequence of the sgRNA at the target mutation site of the gene is: 5'-TCCAGACGTCACTCTTAC-3'( figure 1 Above) This sequence was then constructed into an expression vector.

[0046] 2. Synthesis of single-stranded templates. Synthesize single-stranded templates according to the following sequence. 5' CCAGACCCACGGGAAGTGGCCCGTGAAGTGGTACGCCCCCGAATGCATCAACTACTACAAGTTTCTACAGCAAGAGTGACGTCTGGAGCTTCGGAGTCCTGATGTGGGAAGCGTTTCTCTA-3'.

[0047] 3. Transcribe sgRNA and CAS9 mRNA in vitro, then mix sgRNA, CAS9 mRNA and single-stranded synthetic templates at a final concentration of 50ng / μL and inject them into fertilized eggs with ...

Embodiment 2

[0053] Validation of the phenotype of the Syk-Ser544Tyr mutant mouse model

[0054] 1. The ankle, tail thickness, front and rear paw pad thickness and clinical score of Syk-Ser544Tyr mice were continuously monitored at the age of two weeks. As the age increased, the arthritis phenotype of the mice gradually increased: the joint swelling phenotype began to appear at the age of five weeks , the eight-week-old ankle was obviously red, swollen and deformed, and the clinical score of rheumatoid arthritis in the three-month-old mouse reached more than 10 points, and the motor function of the mouse weakened with age (the mouse's motor ability was monitored by placing the mouse in an iron cage Go up and turn over the cage frame, make the mouse catch on the cage frame upside down, observe its movement and record its falling time) ( figure 2 Left, right); Micro-CT scans showed that the ankle joints and tail vertebrae of point mutant mice were severely eroded ( figure 2 middle).

...

Embodiment 3

[0058] SYK Inhibitor Treats Arthritis in Syk-Ser544Tyr Mutant Mice

[0059] 1. One-month-old and three-month-old point mutant mice were given SYK inhibitor R406 (dissolved in 5% DMSO+95% corn oil) by intragastric administration at a dose of 10 mg / kg per day, and the control group was given The same dose of 5% DMSO+95% corn oil was administered for a total of 28 days, and the arthritis score and ankle thickness of the mice were detected every two days. It was found that R406 can effectively alleviate one month ( Figure 5 left) and three months ( Figure 5 Right) Arthritic phenotype of point mutant mice.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method of a rheumatoid arthritis mouse animal model. Screening is carried out according to a whole genome sequencing result of a human patient, point mutation exists at a specific site of the SYK gene, and it is predicted that the SYK gene is extremely likely to be pathogenic mutation, so that a genetically engineered mouse with Syk gene point mutation at the specific site is successfully obtained by comparing Syk gene sequences of the mouse and utilizing different methods; and the mouse has typical rheumatoid arthritis disease characteristics, and a certain theoretical basis is laid for pathogenic mechanism and treatment research of human rheumatoid arthritis.

Description

technical field [0001] The invention relates to the technical field of animal genetic engineering, in particular to a method for constructing a mouse disease model of rheumatoid arthritis. Background technique [0002] Rheumatoid arthritis (RA) is an autoimmune disease with a high incidence rate. At present, it is believed that the main cause of its pathogenesis is the joint action of genetic factors and environmental factors, which leads to the body misidentifying self-antigens to produce autoantibodies, and a large number of immune cells infiltrate Erosion of articular cartilage and surrounding bone, resulting in continuous joint damage, joint swelling, pain, deformity and even disability, accompanied by many complications, seriously affecting the quality of life of patients. Although there are many clinical research and treatment resources for rheumatoid arthritis in recent years, there is no cure for rheumatoid arthritis. Although methotrexate, the most widely used RA dr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A01K67/027C12N15/90C12N15/12
CPCA01K67/0275C12N15/907C07K14/47A01K2227/105A01K2267/0368A01K2267/0387
Inventor 李大力曾之扬陆佳微曹希雅
Owner EAST CHINA NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com