Check patentability & draft patents in minutes with Patsnap Eureka AI!

Pancreatic cancer tumor marker and application thereof

A technology for tumor markers and pancreatic cancer, applied in the field of biomedical detection, can solve the problems of unimproved sensitivity and specificity

Inactive Publication Date: 2021-07-06
ZHEJIANG UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sensitivity and specificity of CA19-9 in prognostic evaluation have not been improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pancreatic cancer tumor marker and application thereof
  • Pancreatic cancer tumor marker and application thereof
  • Pancreatic cancer tumor marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Verification of the expression level of ANTXR1 in human pancreatic cancer cell lines and human normal pancreatic ductal epithelial cells

[0031] The expression of ANTXR1 in human pancreatic cancer cells BxPC-3 and PANC-1 and human normal pancreatic ductal epithelial cells HPDE6-C7 was analyzed by Western blot and qRT-PCR; the amino acid sequence of ANTXR1 is as follows:

[0032] GELHEDLFFYSEREANRSRDLGAIVYCVGVKDFNETQLARIADSKDHVFPVNDGFQALQGIIHSILKKSCIEILAAEPSTICAGESFQVVVRGNGFRHARNVDRVLCSFKINDSVTLNEKPFSVEDTYLLCPAPILKEVGMKAALQVSMNDGLSFISSSVIITTTHCSDGSILAIAL (SEQ ID NO: 2);

[0033] The nucleotide sequence of the coding gene is as follows:

[0034] ggagaactcc atgaagatct ctttttctat tcagagaggg aggctaatag gtctcgagatcttggtgcaa ttgtttactg tgttggtgtg aaagatttca atgagacaca gctggcccgg attgcggacagtaaggatca tgtgtttccc gtgaatgacg gctttcaggc tctgcaaggc atcatccact caattttgaagaagtcctgc atcgaaattc tagcagctga accatccacc atatgtgcag gagagtcatt tcaagttgtcgtgagaggaa acggcttccg acatg...

Embodiment 2

[0062] Example 2 Expression level of ANTXR1 in pancreatic cancer tissue

[0063] By analyzing the clinical information of 39 pairs of pancreatic cancer tumors and normal pancreas samples downloaded from the Oncomine database, as well as the collected clinical samples of patients, statistical analysis and immunohistochemical methods were used for statistical analysis using statistical software SPSS 20, and quantitative data using single Factor analysis of variance (ANOVA), Pearson chi-square (χ2) test was used for qualitative data, and P<0.05 was used as the significance criterion to analyze and detect the expression level of ANTXR1 in pancreatic cancer and adjacent tissues.

[0064] 1. Immunohistochemistry

[0065] (1) Fixation: fix the tissue in 4% paraformaldehyde solution.

[0066] (2) Dehydration and transparency: add 70%, 80%, 90%, 95%, 95%, 100%, and 100% ethanol for 30 minutes each, and xylene for 1 hour x 2 times.

[0067] (3) Embedding: Soak the tissue in paraffin, ...

Embodiment 3

[0082] Example 3 Relationship Between Expression of ANTXR1 in Pancreatic Cancer Tissue and Tumor Stage

[0083] By performing statistical analysis and immunohistochemical analysis on the collected clinical samples and clinical information of patients with pancreatic cancer, the method of immunohistochemical analysis is the same as that in Example 2. The statistical software SPSS 20 was used for statistical analysis, the Kaplan-Meier method was used for univariate survival analysis, and the log-rank test was used for comparison between groups to analyze the relationship between the expression level of ANTXR1 and tumor stage.

[0084] Table 1: Relationship between ANTXR1 expression and clinicopathological parameters

[0085]

[0086] *P<0.05, the difference is statistically significant

[0087] The results are shown in Table 1 and image 3 , showing that there is no significant correlation between the difference in the expression of ANTXR1 and the patient's age, gender, deg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a pancreatic cancer tumor marker and application thereof. The pancreatic cancer tumor marker has an amino acid sequence shown as SEQ ID NO: 2, and has remarkable sensitivity. Combination of the pancreatic cancer tumor marker with preoperative serum CA19-9 level can more accurately evaluate prognosis of patients with pancreatic cancer, improve prognostic evaluation level, is beneficial to more accurately predict prognosis of tumor patients, and is suitable for large-scale popularization and application The invention provides an inhibitor for the above pancreatic cancer tumor marker as a product for the treatment of pancreatic cancer. The product comprises a reagent for knocking down ANTXR1 gene, can inhibit expression of the pancreatic cancer tumor marker, thereby inhibiting growth of pancreatic cancer tumor cells, and is suitable for large-scale promotion and application.

Description

technical field [0001] The invention belongs to the technical field of biomedical detection, and in particular relates to a pancreatic cancer tumor marker and its application. Background technique [0002] Pancreatic cancer is a common malignant tumor of the digestive system. Due to its special anatomical location and tumor biological behavior, pancreatic cancer has a high degree of malignancy and a very poor prognosis. According to the latest statistics, the number of new cases of pancreatic cancer is increasing year by year, and the five-year survival rate of pancreatic cancer continues to rank the bottom of all tumors, only about 8%, far lower than other tumors. At present, surgical treatment is the main effective means to prolong the survival of patients. However, when pancreatic cancer is diagnosed, only 10% of patients have localized tumors, while up to 52% of patients have distant metastases, resulting in lost opportunities for surgery. Although adjuvant chemotherapy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886G01N33/574
CPCC12Q1/6886G01N33/57438G01N33/57484C12Q2600/158C12Q2600/118
Inventor 曹利平贾盛楠赵冰冰陈炯煌丁国平
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More