Polypeptide for increasing amylose content of plants, and nucleic acid and application thereof
A polynucleotide and plant technology, applied in the fields of crop genetics and biotechnology, can solve problems such as increasing amylose content, and achieve the effect of increasing amylose content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0123] Example 1. Construction of gene editing vectors and screening of mutation sites
[0124] 1. Construct the ABE-nCas9 base editor targeting rice endogenous GBSS1 gene (such as figure 1 shown)
[0125] The ABE base editor can realize the base conversion of A / T->G / C within a certain sequence window range. The present invention uses the ABE-nCas9 base editor as a carrier to design sgRNA in the rice endogenous GBSS1 gene ( The sgRNA shown in Table 1) were respectively cloned into the ABE-nCas9 vector to form a base editor targeting the rice endogenous GBSS1 gene, and the amino acid encoded by the rice endogenous GBSS1 gene is shown in SEQ ID No.1.
[0126] Table 1 The sgRNA sequence targeting the rice GBSS1 gene
[0127] sgRNA ID guide-PAM sequence (5'-3') A-GBSS10 ATGCAGGAGGACGTCCAGAT (SEQ ID NO. 8)
[0128] 2. Genetic transformation of rice and identification of transgenic plants
[0129] The rice variety Xiushui 134 was used as the experimental m...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap