Methods and means for modifying alkaloid content of plants
An alkaloid and plant technology, applied in the fields of regulating gene expression, smoking products, regulating polypeptide constructs, regulating the expression of polypeptides encoded by genes, and can solve problems such as unidentified enzymes or genes.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0543] Example 1 - Transient overexpression of armadillo repeat proteins increases alkaloid content in leaves
[0544] Methods and materials
[0545] clone
[0546] Armadillo repeat protein expression vector
[0547] The gene sequence (SEQ ID No. 3) was amplified from a Gateway™ compatible cDNA library using primers located outside of the restriction sites flanking the gene sequence. The gene sequence is then transferred to an expression vector.
[0548] The resulting plasmid was sequenced and transformed by heat shock into Agrobacterium tumefaciens GV3101 pMP90 and transiently expressed in TN90 leaves.
[0549] transient gene expression
[0550] Agrobacterium tumefaciens GV3101 strains carrying the construct of interest were grown overnight in Luria-Bertani (LB) medium supplemented with appropriate antibiotics. The culture was spun down and resuspended to OD600=0.6 in buffer containing 10 mMMgCl2, 10 mM MES pH 5.6 and 100 µM acetosyringone and incubated for 1 hour at r...
Embodiment 2
[0563] Example 2 - Virus-Induced Gene Silencing (VIGS) of Armadillo Repeat Proteins Reduces Alkaloid Content in Leaves quantity
[0564] Virus-induced gene silencing (VIGS)
[0565] For virus-induced gene silencing, a 300-nucleotide cDNA fragment was synthesized and the following primers were used: Nitab4.5_0002810g0020.2_InFusion 5' TGAGTAAGGTTACCGAATTC (SEQ ID No. 4); and Nitab4.5_0002810g0020.2_InFusion 3' CTCGAGGCCCGGGCATGTCC (SEQ ID No. 5), using the In-Fusion cloning kit to clone into pTV00 (between EcoRI and XhoI sites) to form TRV2-Nitab4.5_0002810g0020.2. The plasmid was then transformed into Agrobacterium tumefaciens GV3101.
[0566] TRV vectors containing both (TRV RNA1 ) and (TRV RNA2 ) containing the targeted nucleotide sequence were propagated separately in Agrobacterium tumefaciens. These cultures were mixed (1:1) and syringe infiltrated into 2-week old TN90 plants. Silencing effects were assessed five weeks after virus infection by assessing the expressi...
Embodiment 3
[0574] Example 3 - Nitab4.5_0002810g0020.2-mediated regulation of alkaloid content requires the Arm domain
[0575] To determine whether the Arm domain is required for the regulation of alkaloid content, a construct was prepared in which the Arm domain of Nitab4.5_0002810g0020.2 was deleted (Delta-Arm).
[0576] The method used to express the construct is as described in Example 1.
[0577] result
[0578] Alkaloid contents of 5-week-old TN90 leaves expressing Nitab4.5_0002810g0020.2 and Nitab4.5_0002810g0020.2 Delta-Arm are shown in image 3 middle. Alkaloid content is expressed relative to control and contains three biological replicates analyzed by one-way ANOVA with Tukey's multiple comparison post hoc test. Values are shown as mean ± SEM. Asterisks indicate statistical significance with a P-value ≤ 0.001.
[0579] Leaves expressing the Nitab4.5_0002810g0020.2-DeltaArm construct contained less nicotine, nornicotine and PON than leaves expressing the Nitab4.5_00028...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More