T cell antigen receptor, polymer complex thereof, and preparation methods and applications of T cell antigen receptor and polymer complex thereof
A technology of cell antigens and complexes, applied in the field of biomedicine, can solve problems such as undisclosed TCR
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0163] Example 1: Construction and Effect Detection of EBV Antigen Epitope Tetramer
[0164] 1. Construction of EBV epitope tetramer
[0165] 1) α chain and β2m chain (whose amino acid sequence is shown in SEQ ID NO: 2) of HLA-A*1101 (whose amino acid sequence is shown in SEQ ID NO: 1, and its nucleotide sequence is shown in SEQ ID NO: 2) expressing sequence optimization shown in NO: 3, and the nucleotide sequence is shown in SEQ ID NO: 4). Wherein, the structure of the α-chain is that the extracellular region sequence of the corresponding HLA-type α-chain is linked with the Avi-tag sequence, separated by BamHI restriction sites to provide biotinylation sites. The β2m chain has the signal peptide sequence removed and two amino acids (M and A) added in front of the mature peptide sequence. The expression vector is PET28a+, and the expression strain is transetta or BL21. The concentration of IPTG was 0.5mM, and the expression was induced for 4h. Extraction of α-chain and β2m...
Embodiment 2
[0182] Embodiment 2: Construction of pHAGE-TCR-RFP carrier
[0183] 1. Obtain the β and α gene fragments of EBV LMP2 epitope-specific TCR
[0184] 1) Take the A1101-SSCSSCPLSK-tetramer and A1101-SSSSCPLTK-tetramer prepared in Example 1, stain with peripheral blood, and perform flow cytometric single-cell sorting on T cells stained positively by tetramer, reverse transcription Obtain cDNA ( IV Reverse Transcriptase, Invitrogen). According to the multiplex PCR (Multiplex PCR) principle, the variable region fragment of the TCRβ gene was amplified by two rounds of PCR (KOD-Plus-Neo, TOYOBO).
[0185] The reverse transcription primer is: TRBC1-TCAGGCAGTATCTGGAGTCATTG (SEQ ID NO: 227)
[0186] PCR amplification primers are:
[0187] Upstream primer 1: TRBV_F1 (SEQ ID NO: 45 to 84, wherein SEQ ID NO: 48 can also be separately used as the TRBV_F1 of the variable region fragment of the β gene of E141, E149, E304, E314 and E301, SEQ ID NO: 62 can also be used alone as the TRBV_F1 ...
Embodiment 3
[0210] Example 3: Detection of membrane expression and affinity of TCR by pMHC tetramer staining
[0211] 1. Construction of endogenous TCR knockout JurkatT cell line
[0212] Based on the sequence characteristics of TCR in Jurkat cells, guide sequences were designed in the constant regions of the α chain and β chain (TRA_oligo1-CACCGTCTCTCAGCTGGTACACGGC (SEQ ID NO: 247), TRA_oligo2-AAACGCCGTGTACCAGCTGAGAGAC (SEQ ID NO: 248), TRB_oligo1-CACCGGGCTCAACACAGCGACCTC (SEQ ID NO: 249), TRB_oligo2 AAACGAGGTCGCTGTGTTTGAGCCC) (SEQ ID NO: 250).
[0213] The guide sequences of the synthesized α-chain and β-chain were respectively constructed into sgRNA-LentiCRISPR-puro and sgRNA-LentiCRISPR-BSD lentiviral vectors, and co-transfected with packaging plasmids psPAX2, pMD2.G and PEI transfection reagents in a certain ratio to 293T Cells, the cell culture supernatants of 48h and 72h were collected, and the concentrated two viruses simultaneously infected the human JurkatT cell line. 48 hours...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


