T cell antigen receptor, polymer complex thereof, and preparation methods and applications of T cell antigen receptor and polymer complex thereof

A technology of cell antigens and complexes, applied in the field of biomedicine, can solve problems such as undisclosed TCR

Pending Publication Date: 2021-11-09
CHINA IMMUNOTECH BEIJING BIOTECH CO LTD +1
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the TCR of the present invention is not disclosed in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • T cell antigen receptor, polymer complex thereof, and preparation methods and applications of T cell antigen receptor and polymer complex thereof
  • T cell antigen receptor, polymer complex thereof, and preparation methods and applications of T cell antigen receptor and polymer complex thereof
  • T cell antigen receptor, polymer complex thereof, and preparation methods and applications of T cell antigen receptor and polymer complex thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0163] Example 1: Construction and Effect Detection of EBV Antigen Epitope Tetramer

[0164] 1. Construction of EBV epitope tetramer

[0165] 1) α chain and β2m chain (whose amino acid sequence is shown in SEQ ID NO: 2) of HLA-A*1101 (whose amino acid sequence is shown in SEQ ID NO: 1, and its nucleotide sequence is shown in SEQ ID NO: 2) expressing sequence optimization shown in NO: 3, and the nucleotide sequence is shown in SEQ ID NO: 4). Wherein, the structure of the α-chain is that the extracellular region sequence of the corresponding HLA-type α-chain is linked with the Avi-tag sequence, separated by BamHI restriction sites to provide biotinylation sites. The β2m chain has the signal peptide sequence removed and two amino acids (M and A) added in front of the mature peptide sequence. The expression vector is PET28a+, and the expression strain is transetta or BL21. The concentration of IPTG was 0.5mM, and the expression was induced for 4h. Extraction of α-chain and β2m...

Embodiment 2

[0182] Embodiment 2: Construction of pHAGE-TCR-RFP carrier

[0183] 1. Obtain the β and α gene fragments of EBV LMP2 epitope-specific TCR

[0184] 1) Take the A1101-SSCSSCPLSK-tetramer and A1101-SSSSCPLTK-tetramer prepared in Example 1, stain with peripheral blood, and perform flow cytometric single-cell sorting on T cells stained positively by tetramer, reverse transcription Obtain cDNA ( IV Reverse Transcriptase, Invitrogen). According to the multiplex PCR (Multiplex PCR) principle, the variable region fragment of the TCRβ gene was amplified by two rounds of PCR (KOD-Plus-Neo, TOYOBO).

[0185] The reverse transcription primer is: TRBC1-TCAGGCAGTATCTGGAGTCATTG (SEQ ID NO: 227)

[0186] PCR amplification primers are:

[0187] Upstream primer 1: TRBV_F1 (SEQ ID NO: 45 to 84, wherein SEQ ID NO: 48 can also be separately used as the TRBV_F1 of the variable region fragment of the β gene of E141, E149, E304, E314 and E301, SEQ ID NO: 62 can also be used alone as the TRBV_F1 ...

Embodiment 3

[0210] Example 3: Detection of membrane expression and affinity of TCR by pMHC tetramer staining

[0211] 1. Construction of endogenous TCR knockout JurkatT cell line

[0212] Based on the sequence characteristics of TCR in Jurkat cells, guide sequences were designed in the constant regions of the α chain and β chain (TRA_oligo1-CACCGTCTCTCAGCTGGTACACGGC (SEQ ID NO: 247), TRA_oligo2-AAACGCCGTGTACCAGCTGAGAGAC (SEQ ID NO: 248), TRB_oligo1-CACCGGGCTCAACACAGCGACCTC (SEQ ID NO: 249), TRB_oligo2 AAACGAGGTCGCTGTGTTTGAGCCC) (SEQ ID NO: 250).

[0213] The guide sequences of the synthesized α-chain and β-chain were respectively constructed into sgRNA-LentiCRISPR-puro and sgRNA-LentiCRISPR-BSD lentiviral vectors, and co-transfected with packaging plasmids psPAX2, pMD2.G and PEI transfection reagents in a certain ratio to 293T Cells, the cell culture supernatants of 48h and 72h were collected, and the concentrated two viruses simultaneously infected the human JurkatT cell line. 48 hours...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a T cell antigen receptor, an immune cell for expressing the T cell antigen receptor (TCR), and preparation methods and applications of the T cell antigen receptor and the immune cell. The TCR provided by the invention can specifically recognize a corresponding pMHC complex and activate TCR-T cells, so that high-level cell factors IFN[gamma], IL2 and TNF[alpha] are generated, target cells are remarkably killed, and the service life of a tumor-loaded mouse is prolonged.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to an antibody or its antigen-binding fragment, a T cell antigen receptor, a multimer complex, and a preparation method and application thereof. Background technique [0002] Epstein-Barr virus (EBV) is a gamma herpes virus isolated from samples of Burkitt's lymphoma (Burkitt's lymphoma, BL) by Epstein and Barr in 1964, and it is also the first recognized tumorigenic Virus. The primary infection of EBV mainly occurs in the epithelial cells of the human oropharynx. Later, because of its remarkable B-lymphophilic characteristics, it can infect B cells and exist in memory B cells for a long time, leading to life-long carrier of the infected person. The positive rate of virus antibody in serum exceeds 90%. Although EBV infection does not pose much of a threat to the vast majority of immunocompetent individuals, EBV can cause a variety of life-threatening diseases in people with co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/85C12N5/10A61K39/00A61P35/00A61P31/22
CPCC07K14/7051A61P31/22A61P35/00C07K14/70539C07K16/085G01N33/56994G01N33/574A61K39/4611A61K39/464838A61K2239/31A61K2239/38A61K39/4644A61K39/4632A61K2239/48C12N5/0636C07K2319/03A61K39/12A61P31/20C12N2710/16234A61K2039/585A61K2039/64C12N2510/00C12N2501/2302C12N2502/30C12N15/86A01K2207/12A01K2227/105A01K2267/0331C12N2740/16043C07K2317/565C07K2317/622A61K35/17
Inventor贾乐梅陈花李文忠王嘉盛雷蕾刘芳赵学强林欣
OwnerCHINA IMMUNOTECH BEIJING BIOTECH CO LTD