Unlock instant, AI-driven research and patent intelligence for your innovation.

Therapeutic agent for dystrophic epidermolysis bullosa

A bad type, bullous technology, applied in gene therapy, skin diseases, tissue culture, etc., can solve the problem that there is no effective treatment for epidermolysis bullosa

Pending Publication Date: 2021-11-12
OSAKA UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] No effective treatment currently exists for epidermolysis bullosa, and development of gene therapies that suppress blistering at its root needs to be developed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Therapeutic agent for dystrophic epidermolysis bullosa
  • Therapeutic agent for dystrophic epidermolysis bullosa
  • Therapeutic agent for dystrophic epidermolysis bullosa

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0135] 1. Design of Genome Editing

[0136] Three types of sgRNA were prepared to select a site with good cleavage efficiency by the CRISPR-Cas9 system in the AAVS1 (adeno-associated virus integration site 1) region in the human genome. The AAVS1 region is a safe region (safe harbor) that is less susceptible to gene transfer. Since the CRISPR-Cas9 system recognizes the base sequence of "NGG" and cleaves 3 bases upstream of the sequence, regions each having "GG" at the end are selected, and each is designed to contain 20 bases upstream of "NGG". base sequence of sgRNA (sgAAVS1-#1 to #3) ( figure 1 , top; Table 1).

[0137] Table 1

[0138] sgRNA target sequence SEQ ID NO. sgAAVS1-#1 ACCCCACAGTGGGGCCACTA 3 sgAAVS1-#2 GTCACCAATCCTGTCCCTAG 4 sgAAVS1-#3 GGGGCCACTAGGGACAGGAT 5

[0139] An oligonucleotide consisting of the sequence of any one of SEQ ID NO: 3 to 5 was annealed to its complementary strand and cloned into the Bbs1 site of eS...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The present disclosure pertains to a composition to be used in treating dystrophic epidermolysis bullosa, said composition containing dystrophic epidermolysis bullosa patient's cells having been genetically engineered so as to produce type VII collagen, wherein the cells are mesenchymal stem cells. The present disclosure also pertains to a composition to be used in treating dystrophic epidermolysis bullosa, said composition containing type VII collagen-producing cells and being to be administered into blisters.

Description

technical field [0001] This application claims priority with respect to Japanese Patent Application No. 2019-007201, which is incorporated herein by reference in its entirety. [0002] The present disclosure relates to compositions for treating dystrophic epidermolysis bullosa. Background technique [0003] Epidermolysis bullosa is a disease in which adhesive structural molecules responsible for skin tissue adhesion are lost or disappeared, and then the epidermis is peeled off from the dermis, and when force is applied to the skin, blisters or skin ulcers appear. The disorders include epidermolysis bullosa simplex (in which the epidermis tears to form blisters), epidermolysis bullosa junctional (in which the epidermis separates from the basement membrane to form blisters), and dystrophic epidermolysis bullosa Epidermolysis (in which the basement membrane is peeled off from the dermis). [0004] Dystrophic epidermolysis bullosa is the most common type of epidermolysis bullo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61P17/00A61P17/02A61K38/39A61K35/28C12N15/113
CPCA61P17/00A61K48/00A61K38/39A61K35/28C12N15/907A01K2227/105A01K2217/075A01K2267/0306C12N15/113C12N2310/20A61P17/02C12N5/0663C07K14/78C12N2510/00A61K9/0019C07H21/02
Inventor 玉井克人菊池康玉越智树
Owner OSAKA UNIV