SNP locus related to per-spike spikelet number and per-spike grain number characters of wheat and application of SNP locus
A technology for the number of spikelets and loci, applied in the field of SNP loci, can solve problems such as difficulty in practical use and difficulty in stable expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 SNP and PCR-enzyme polymorphism detection related to the number of grains per ear of wheat
[0031] 1. Specific primers and sequence analysis for amplifying the genomic fragment containing the SNP in wheat
[0032] A SNP found in the exon region of the gene DPY1 on the wheat genome corresponds to the 1010th position from the 5' end of SEQ ID NO: 11 in the sequence table, and it is found that there are two genotypes at this site in the wheat natural variation population:
[0033] Genotype A: G
[0034] Genotype B: A
[0035] According to the sequence differences of different genomes of wheat, specific primers were designed to PCR amplify the DNA fragments respectively including the SNP site:
[0036] F1: TCTGGACAGGCTATTG (SEQ ID NO: 2);
[0037] R1: AATTCCCAGCAATGCTG (SEQ ID NO: 3);
[0038] F2: CTTTCCCTCTGTGTACACTGCA (SEQ ID NO: 4);
[0039] R2: AACAAGAATAACTAAGGG (SEQ ID NO: 5).
[0040] Using F1 and R1 as primers for the target sequence of PCR amplific...
Embodiment 2
[0062] In 2015, the hydrothermal field and water field at the experimental farm of the Institute of Crop Science, Chinese Academy of Agricultural Sciences (Shunyi, Beijing), in 2016 at the experimental farm of the Institute of Crop Science, Chinese Academy of Agricultural Sciences (Shunyi and Changping, Beijing) Plant the above-mentioned natural population wheat, investigate the number of spikelets per ear of each wheat variety, carry out association analysis with the situation of the number of spikelets per ear and the polymorphic site with Tassel2.1 software, select mixed linear model+population structure ( MLM+(Q+K)) method was used for analysis, with P<0.05 as the significance level, the results are shown in Table 2.
[0063] Table 2 The results of the association analysis between the polymorphism of DPY1-A gene and the number of spikelets per panicle in natural populations
[0064]
[0065] The results of the association analysis in Table 2 showed that the difference i...
Embodiment 3
[0067] In 2015, the above-mentioned natural group wheat was planted in the dry land of the Experimental Farm of the Institute of Crop Science of the Chinese Academy of Agricultural Sciences (Shunyi, Beijing), and in 2016 in the dry and wet land of the Experimental Farm of the Institute of Crop Science of the Chinese Academy of Agricultural Sciences (Shunyi and Changping, Beijing). The number of grains per ear of each wheat variety is associated with the situation of the number of grains per ear and the polymorphic site with Tassel2.1 software, and the mixed linear model+population structure (MLM+(Q+K)) method is selected to analyze, With P<0.05 as the significance level, the results are shown in Table 3.
[0068] Table 3. The results of the association analysis between the polymorphism of DPY1-A gene and the number of grains per panicle in natural populations
[0069]
[0070] The results of the association analysis in Table 3 showed that the difference in the number of gra...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


