Unlock instant, AI-driven research and patent intelligence for your innovation.

SNP locus related to per-spike spikelet number and per-spike grain number characters of wheat and application of SNP locus

A technology for the number of spikelets and loci, applied in the field of SNP loci, can solve problems such as difficulty in practical use and difficulty in stable expression

Active Publication Date: 2021-11-26
HEBEI NORMAL UNIV
View PDF7 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the vast majority of these QTLs are minor QTLs, and it is difficult to express stably in different environments, it is difficult to be practical

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP locus related to per-spike spikelet number and per-spike grain number characters of wheat and application of SNP locus
  • SNP locus related to per-spike spikelet number and per-spike grain number characters of wheat and application of SNP locus
  • SNP locus related to per-spike spikelet number and per-spike grain number characters of wheat and application of SNP locus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 SNP and PCR-enzyme polymorphism detection related to the number of grains per ear of wheat

[0031] 1. Specific primers and sequence analysis for amplifying the genomic fragment containing the SNP in wheat

[0032] A SNP found in the exon region of the gene DPY1 on the wheat genome corresponds to the 1010th position from the 5' end of SEQ ID NO: 11 in the sequence table, and it is found that there are two genotypes at this site in the wheat natural variation population:

[0033] Genotype A: G

[0034] Genotype B: A

[0035] According to the sequence differences of different genomes of wheat, specific primers were designed to PCR amplify the DNA fragments respectively including the SNP site:

[0036] F1: TCTGGACAGGCTATTG (SEQ ID NO: 2);

[0037] R1: AATTCCCAGCAATGCTG (SEQ ID NO: 3);

[0038] F2: CTTTCCCTCTGTGTACACTGCA (SEQ ID NO: 4);

[0039] R2: AACAAGAATAACTAAGGG (SEQ ID NO: 5).

[0040] Using F1 and R1 as primers for the target sequence of PCR amplific...

Embodiment 2

[0062] In 2015, the hydrothermal field and water field at the experimental farm of the Institute of Crop Science, Chinese Academy of Agricultural Sciences (Shunyi, Beijing), in 2016 at the experimental farm of the Institute of Crop Science, Chinese Academy of Agricultural Sciences (Shunyi and Changping, Beijing) Plant the above-mentioned natural population wheat, investigate the number of spikelets per ear of each wheat variety, carry out association analysis with the situation of the number of spikelets per ear and the polymorphic site with Tassel2.1 software, select mixed linear model+population structure ( MLM+(Q+K)) method was used for analysis, with P<0.05 as the significance level, the results are shown in Table 2.

[0063] Table 2 The results of the association analysis between the polymorphism of DPY1-A gene and the number of spikelets per panicle in natural populations

[0064]

[0065] The results of the association analysis in Table 2 showed that the difference i...

Embodiment 3

[0067] In 2015, the above-mentioned natural group wheat was planted in the dry land of the Experimental Farm of the Institute of Crop Science of the Chinese Academy of Agricultural Sciences (Shunyi, Beijing), and in 2016 in the dry and wet land of the Experimental Farm of the Institute of Crop Science of the Chinese Academy of Agricultural Sciences (Shunyi and Changping, Beijing). The number of grains per ear of each wheat variety is associated with the situation of the number of grains per ear and the polymorphic site with Tassel2.1 software, and the mixed linear model+population structure (MLM+(Q+K)) method is selected to analyze, With P<0.05 as the significance level, the results are shown in Table 3.

[0068] Table 3. The results of the association analysis between the polymorphism of DPY1-A gene and the number of grains per panicle in natural populations

[0069]

[0070] The results of the association analysis in Table 3 showed that the difference in the number of gra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a SNP locus related to per-spike spikelet number and per-spike grain number characters of wheat and application of the SNP locus and comprises a kit, primer and related molecular marker for identifying or assisting in identifying the per-spike spikelet number and per-spike grain number characters of the wheat, and application of the elements in identifying or assisting in identifying the per-spike spikelet number and per-spike grain number characters of the wheat. The invention provides a new method for molecular marker-assisted selective breeding of wheat, and has an important significance in cultivation and research of high-yield wheat varieties.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a SNP site related to the number of spikelets and grains per ear of wheat and its application. Background technique [0002] Wheat (Triticum aestivum L) is an important food crop in the world, and improving wheat yield is one of the main goals of breeders. With the increase of the population, increasing the yield of wheat per unit area to ensure the stable yield of wheat is an important way to meet the increasing demand for food in recent years. Wheat yield is composed of three elements, the number of ears per unit area, the number of grains per ear and the weight of thousand grains. These three factors are also called the yield structure of wheat, and the product of the three factors is the yield per unit area of ​​wheat. The number of spikelets per panicle is the key factor affecting the number of grains per panicle. At the same time, the number of grai...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11
CPCC12Q1/6895C12Q1/6858C12Q2600/13C12Q2600/156C12Q2600/172C12Q2531/113C12Q2521/301
Inventor 刘西岗张腾腾张琦郭琳李永鹏景瑞莲
Owner HEBEI NORMAL UNIV