A molecular marker detection kit, nucleic acid combination and application of primary liver cancer
A primary liver cancer, molecular marker technology, applied in the determination/inspection of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of low sensitivity and accuracy, and few blood markers for hepatocellular carcinoma and other problems, to achieve the effect of reducing morbidity and mortality, increasing the proportion of early diagnosis, and high accuracy of early screening
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] This embodiment provides a diagnostic reagent for primary liver cancer. It includes nucleic acid combination 1.
[0052] Nucleic acid combination 1 includes primer combination 1 and probe 1, primer combination 1 includes nucleotides shown in SEQ ID NO.7-8, and the base sequence of probe 1 is shown in SEQ ID NO.9. This nucleic acid combination 1 can detect the methylation level of the Chr2:25216048-25216151 region positive strand (target region 1).
[0053] The upstream primer sequence for region 1 methylation-specific PCR is (5’-3’):
[0054] GTTATTTCGGCGAGTAGAGTCG (SEQ ID NO. 7);
[0055] The downstream primer sequences for region 1 methylation-specific PCR are (5'-3'):
[0056] AACTACCCGCGAAAACTTCCG (SEQ ID NO. 8);
[0057] The sequence of probe 1 for region 1 methylation-specific PCR is (5’-3’):
[0058] TCGGTGCGTTGGTTTCGTTCG (SEQ ID NO. 9).
Embodiment 2
[0060] This embodiment provides a diagnostic reagent for primary liver cancer. It includes nucleic acid combination 2.
[0061] Nucleic acid combination 2 includes primer combination 2 and probe 2, primer combination 2 includes nucleotides shown in SEQ ID NO.10-11, and the base sequence of probe 2 is shown in SEQ ID NO.12. This nucleic acid combination 2 can detect the methylation level of Chr2: 25216146-25216277 region positive strand (target region 2).
[0062] The upstream primer sequence of region 2 methylation-specific PCR is (5'-3'): GTAGTTGGGGAGGAAATCGC (SEQID NO.10);
[0063] The downstream primer sequences for region 2 methylation-specific PCR are (5'-3'):
[0064] AACACTCCGACTAACGACGC (SEQ ID NO. 11);
[0065] The sequence of probe 2 for region 2 methylation-specific PCR is (5’-3’):
[0066] TTCGGTTCGGGAAGGGTAGTGC (SEQ ID NO. 12).
Embodiment 3
[0068] This embodiment provides a diagnostic reagent for primary liver cancer. It includes nucleic acid combination 3.
[0069] Nucleic acid combination 3 includes primer combination 3 and probe 3, primer combination 3 includes nucleotides shown in SEQ ID NO.13-14, and the base sequence of probe 3 is shown in SEQ ID NO.15. This nucleic acid combination 3 can detect the methylation level of Chr2: 25216265-25216351 region positive strand (target region 3).
[0070] The upstream primer sequence of region 3 methylation-specific PCR is (5'-3'): TAGTCGGAGTGTTCGGCGTTC (SEQ ID NO.13);
[0071] The downstream primer sequences for region 3 methylation-specific PCR are (5'-3'):
[0072] ACTACGAACTAAAACTCCGCAACGT (SEQ ID NO. 14);
[0073] The sequence of probe 3 for region 3 methylation-specific PCR is (5'-3'):
[0074] TTTTTGCGTCGGTTTAGGATTCGTA (SEQ ID NO. 15).
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
| Sensitivity | aaaaa | aaaaa |
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



