Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for gene editing in soybean by using Cas12i

A gene editing and soybean technology, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve the problems of inability to reflect editing activity and low editing efficiency of dicotyledonous plants, and achieve the effect of increasing oleic acid content

Inactive Publication Date: 2022-03-01
SHANDONG SHUNFENG BIOTECH CO LTD
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When the inventors studied the editing activity of the enzyme in dicotyledonous plants (such as Arabidopsis, soybean, etc.), they found that the editing efficiency of the enzyme in dicotyledonous plants was low, and even some sites could not show editing activity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for gene editing in soybean by using Cas12i
  • Method for gene editing in soybean by using Cas12i

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0071] Example 1. Gene editing in soybean by Cas12i-based CRISPR gene editing technology

[0072] 1. Gene editing vector construction

[0073] In this embodiment, Cas12i (amino acid sequence shown in SEQ ID No.1) is used for gene editing in soybean.

[0074] According to the coding sequences of GmFAD2-1A, GmFAD2-1B and GmFT5α genes in soybean, the gRNA for Cas12i was designed, and the designed gRNA sequence was as follows:

[0075] gRNA Guide sequence for gRNA (5' to 3') PAM target gene gRNA 1 cuguaccaauacacgcccuucuc ttc GmFAD2-1A / B gRNA 2 ccucauugcauggccaaucuauu ttc GmFAD2-1A / B gRNA 3 ucuccacagugccuuguaaaaug ttc GmFAD2-1A / B gRNA 4 caaacacaaagccaccauucacu ttc GmFAD2-1A / B gRNA 5 uggacggauugcauucauag tta GmFT5α

[0076] The direct repeat sequence of the above gRNA is agagaaugugugcauagucacac (5' to 3'). The above-mentioned gRNA1-gRNA5 sequentially include the above-mentioned direct repeat sequences and r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for carrying out gene editing in soybean by using Cas12i, the method comprises a step of carrying out gene editing in soybean by using Cas12i and gRNA, the gRNA comprises a skeleton region combined with Cas12i and a guide series hybridized with a target sequence, and the gRNA targets a GmFAD2-1A gene and a GmFAD2-1B gene of soybean; the amino acid sequence of the Cas12i is as shown in SEQ ID No. 1, and the guide sequence, hybridized with the target sequence, in the gRNA is as shown in SEQ ID No. 2.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for gene editing in soybeans, in particular to a method for using Cas12i to perform gene editing in soybeans. Background technique [0002] Soybean is the main source of oil and protein for human beings, one of the most important economic crops in the world, and the main source of human vegetable oil and vegetable protein. With the improvement of living standard and improvement of diet structure, people's demand for high-quality soybean oil is increasing day by day, and cultivating high-quality soybean has become one of the important goals of soybean breeding. [0003] The CRISPR / Cas9 system is the most commonly used type II CRISPR system, which recognizes the PAM motif of 3’-NGG and performs blunt-end cleavage of the target sequence. The site-directed editing of the target gene is achieved through the mediation of the guide RNA and the cleavage of the Cas9 prot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/53C12N9/22C12N15/113A01H5/10A01H5/00A01H6/54
CPCC12N15/8218C12N15/8247C12N9/001C12N9/22C12Y103/01035
Inventor 谢洪涛
Owner SHANDONG SHUNFENG BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products