Method for gene editing in soybean by using Cas12i
A gene editing and soybean technology, applied in genetic engineering, plant genetic improvement, botanical equipment and methods, etc., can solve the problems of inability to reflect editing activity and low editing efficiency of dicotyledonous plants, and achieve the effect of increasing oleic acid content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0071] Example 1. Gene editing in soybean by Cas12i-based CRISPR gene editing technology
[0072] 1. Gene editing vector construction
[0073] In this embodiment, Cas12i (amino acid sequence shown in SEQ ID No.1) is used for gene editing in soybean.
[0074] According to the coding sequences of GmFAD2-1A, GmFAD2-1B and GmFT5α genes in soybean, the gRNA for Cas12i was designed, and the designed gRNA sequence was as follows:
[0075] gRNA Guide sequence for gRNA (5' to 3') PAM target gene gRNA 1 cuguaccaauacacgcccuucuc ttc GmFAD2-1A / B gRNA 2 ccucauugcauggccaaucuauu ttc GmFAD2-1A / B gRNA 3 ucuccacagugccuuguaaaaug ttc GmFAD2-1A / B gRNA 4 caaacacaaagccaccauucacu ttc GmFAD2-1A / B gRNA 5 uggacggauugcauucauag tta GmFT5α
[0076] The direct repeat sequence of the above gRNA is agagaaugugugcauagucacac (5' to 3'). The above-mentioned gRNA1-gRNA5 sequentially include the above-mentioned direct repeat sequences and r...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com